Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for Recombinant Mouse icos ligand His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Recombinant CEACAM-His proteins were expressed in Expi293F cells (Life Technologies) and purified by affinity chromatography (ÄKTA Pure ...
-
bioRxiv - Microbiology 2022Quote: ... Mouse-anti-His (HIS.H8) antibody (Invitrogen) (for eGFP/His-tagged NP protein co-immunoprecipitation ...
-
bioRxiv - Biochemistry 2021Quote: ... His (1:1000, Invitrogen, mouse monoclonal), Flag M2(1:1000 ...
-
bioRxiv - Synthetic Biology 2022Quote: All antigens were His-tagged and purified using HisPur™ Ni-NTA resin (ThermoFisher). Cell supernatants were diluted with 1/3rd volume wash buffer [20 mM imidazole ...
-
bioRxiv - Biochemistry 2021Quote: ... The His-tagged proteins were purified using HisPur Ni-NTA resin (Thermo Fisher Scientific), at RT ...
-
bioRxiv - Cancer Biology 2020Quote: ... HA-tagged RON was cloned into the expression vector pcDNA3.1/V5-His-TOPO (Invitrogen) by fusion PCR ...
-
bioRxiv - Immunology 2020Quote: ... The His-tagged proteins were purified with the HisPur Ni-NTA Resin (Thermo Fisher). To eliminate nonspecific binding proteins ...
-
bioRxiv - Molecular Biology 2020Quote: ... His-tagged hAgo2 was purified from Sf9 cells using a baculovirus system (Thermo Fisher). Cells were lysed in Lysis Buffer (300mM NaCl ...
-
bioRxiv - Biochemistry 2022Quote: ... His-tagged protein was labeled with Alexa Fluor 488 NHS Ester (Thermo Fisher Scientific) per manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... The His-tagged dAsapPZA protein was expressed and purified following manufacturer guidelines (Invitrogen, USA).
-
bioRxiv - Cancer Biology 2024Quote: ... 1% mouse recombinant EGF (Invitrogen, 5% Recombinant human R-spondin (Peprotech).
-
bioRxiv - Cell Biology 2020Quote: ... His6-tagged recombinant proteins were produced in BL21 (DE3) grown in MagicMedia (Invitrogen) 24h ...
-
bioRxiv - Molecular Biology 2021Quote: ... and GST-tagged recombinant proteins were retained on glutathione magnetic beads (Fisher Scientific). On-bead recombinant proteins were washed with the respective lysis buffer ...
-
bioRxiv - Cell Biology 2019Quote: Recombinant GST and GST-tagged EB1 were transformed into E.coli BL21 (DE3) (Invitrogen). Bacterial cultures were grown to OD600 of 0.7 and induced with 1 mM IPTG for 5.5 h at 25°C ...
-
bioRxiv - Immunology 2022Quote: ... and CD278/ICOS PE (ISA-3, Thermo Fisher Scientific). Cells were stained as described above ...
-
bioRxiv - Biochemistry 2021Quote: ... His-tagged RRs were purified from clarified lysate using HisPur Ni-NTA resin (Thermo Scientific) or HisPur Cobalt resin (Thermo Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... His-tagged proteins were visualised using a primary anti-6xhis antibody (ArtNr: 11533923, Fisher Scientific), a HRP-coupled secondary antibody (ArtNr ...
-
bioRxiv - Neuroscience 2023Quote: ... The His-tagged dAsapPZA protein was expressed and purified following the manufacturer’s guidelines (Invitrogen, USA).
-
bioRxiv - Microbiology 2023Quote: ... His-tagged LCRIS_00661 and LCRIS_00558 genes with the appropriate restriction sites were ordered from Invitrogen and subcloned into a previously constructed S ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-His (MA1-21315, Thermo Scientific), mouse anti-β-actin HRP (Santa Cruz Biotechnologies ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-His Tag (Invitrogen MA1-21315). Secondary antibody used are ...
-
bioRxiv - Microbiology 2022Quote: ... mouse monoclonal anti-6x-His (Thermo Fisher) diluted 1:1,000 ...
-
bioRxiv - Microbiology 2022Quote: ... recombinant proteins were detected using primary anti-His antibody (ThermoFisher, Cat. # PA1-983B) and an anti-RNAP antibody (BioLegend ...
-
bioRxiv - Immunology 2019Quote: ... we added recombinant mouse IFNγ (ThermoFisher), 2-deoxyglucose (Abcam) ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse recombinant Egf (Life Technologies #PMG8043), 100 ng/mL mouse recombinant Noggin (Peprotech #250-38 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Sybr Safe DNA gel stain and BenchMark™ His-tagged Protein Standard were purchased from Invitrogen. HRP-conjugated 6*His His-Tag Mouse McAB was obtained from Proteintech ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... His-tagged proteins were eluted from the beads in a disposable polypropylene column (29924, ThermoFisher Scientific) using elution buffer (4 ml wash buffer containing 400 mM imidazole ...
-
bioRxiv - Neuroscience 2020Quote: ... media was collected and His tagged proteins were bound using HisPur Ni-NTA Resin (ThermoFisher; 88221) in the presence of Calbiochem’s EDTA-free protease inhibitor cocktail 1:1000 (MilliporeSigma ...
-
bioRxiv - Biochemistry 2021Quote: 1-2 μg His-tagged calcineurin was first bound to magnetic Dynabeads (Thermo Fisher Sci. USA) in base buffer (50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Plant Biology 2023Quote: ... His-tagged AtKu70/80 was isolated from the supernatant using HisPur Ni-NTA resins (Thermo Fisher) and dialysed in 20 mM HEPES pH7.5 ...
-
bioRxiv - Biophysics 2022Quote: ... The His tagged RBD construct was purified from the culture supernatant of Expi293 cells (Thermo Fisher) that were transfected with the plasmid DNA using FectoPRO (Polyplus Inc.) ...
-
Co-stimulatory molecules decide T cell fate through regulations of their invigoration and impairmentbioRxiv - Molecular Biology 2022Quote: ... gRNA (CD28: TCGGCATTCGAGCGAAACTG, ICOS: AGGTTCCTTTCTTGAAAAGG) with Cas9 protein (Thermo Fisher) was incubated for 5 min ...
-
bioRxiv - Microbiology 2019Quote: ... mouse anti-His antibody (Thermo Fisher, Waltham, MA) was diluted 1:2000 in 1x iBind solution ...
-
bioRxiv - Microbiology 2022Quote: ... and mouse anti His Alexa Fluor 555 (Invitrogen catalogue number MA1-135-A555 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-His (Invitrogen, #MA1-21315, 1:1000), rabbit anti-GST (Merck,#ZRB1223,1:1000) ...
-
bioRxiv - Microbiology 2023Quote: ... anti-6x-His mouse monoclonal (Invitrogen 37-2900), anti-CD99 mouse monoclonal (Invitrogen MA5-12954) ...
-
bioRxiv - Biochemistry 2021Quote: GST-tagged p107 constructs loaded on beads were phosphorylated with recombinant Cyclin A/CDK2 (Invitrogen) in 200 nM ATP KAS buffer (5 mM HEPES pH 7.2 ...
-
bioRxiv - Biochemistry 2022Quote: ... Alexafluor-594 tagged recombinant cholera toxin subunit B (CTB-red) was also purchased from Invitrogen Molecular Probes and used as per manufacturer’s recommendations (10 µM final concentration).
-
bioRxiv - Molecular Biology 2023Quote: GST-tagged p107 constructs loaded on beads were phosphorylated with recombinant cyclin B/CDK1 (Invitrogen) in 200 nM ATP KAS buffer (5 mM HEPES pH 7.2 ...
-
bioRxiv - Cancer Biology 2022Quote: Recombinant human IFNγ (PHC4031) and recombinant mouse IFNγ (PMC4031) were purchased from Gibco and used at the indicated concentrations ...
-
bioRxiv - Biochemistry 2019Quote: His-tagged SIVsmm Nef constructs were expressed in BL21 (DE3) star cells (Life technologies, Grand Island, NY), and induced with 0.3 mM IPTG at 25 °C overnight ...
-
bioRxiv - Plant Biology 2021Quote: ... Purified His-tagged proteins were resolved by SDS-PAGE (NuPAGE 4-12% Bis-Tris Protein Gels, Invitrogen) and gels were stained with Quick Coomassie Stain (Generon) ...
-
bioRxiv - Microbiology 2022Quote: ... His-tagged proteins were purified using HisPur™ Ni-NTA resin (Thermo Fisher Scientific Cat. Nr. 88222) according to manufacturer’s instructions (batch protocol) ...
-
bioRxiv - Genetics 2021Quote: Plasmids expressing GST- and His-tagged proteins were transformed into BL21(DE3) competent cells (Thermo Scientific, EC0114) and grown in LB media at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... 6x-His-tagged constructs of human and murine SNED1 cloned into pCDNA5/FRT (Thermo Fisher, Waltham, MA) between the FseI and AscI sites were used to transiently transfect 293T cells to validate the anti-SNED1 antibody generated in this study (Supplementary Figure S1) ...
-
bioRxiv - Immunology 2022Quote: ... The His-tagged proteins were purified with the HisPur Ni-NTA Resin (Thermo Fisher Scientific cat.# 88221). After washing by wash buffer (25 mM Imidazole ...
-
bioRxiv - Immunology 2023Quote: ... Filtered supernatants containing His-tagged proteins were passed slowly through HisPur Ni-NTA Resin (Thermo Fisher 88221) beads in columns ...
-
bioRxiv - Biochemistry 2023Quote: ... The His tag was digested during 14h at 4°C with histidine-tagged 3C proteases (Thermo Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... His-tagged FH(44-511) was purified from the lysate using HisPurTM Cobalt Spin Columns (Thermo Fisher). Columns were washed using with buffer A (50 mM sodium phosphate pH 7.4 ...
-
bioRxiv - Synthetic Biology 2023Quote: All RBD antigens were His-tagged and purified using HisPur Ni-NTA resin (Thermo Fisher Scientific, 88222). Cell supernatants were diluted with 1/3 volume of wash buffer (20 mM imidazole ...