Labshake search
Citations for Thermo Fisher :
601 - 650 of 10000+ citations for Recombinant Mouse Il1f6 None tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD proteins were produced in transfected FreeStyle 293F cells (Invitrogen) and purified by nickel affinity chromatography ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant soluble DPP4 was coated on NUNC Maxisorp plates (Thermo Scientific) at 100 ng/well at RT for 3 h ...
-
bioRxiv - Microbiology 2021Quote: ... Reactions were performed using Taq DNA Polymerase Recombinant kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... and 20 ng/mL thermostable recombinant human Fibroblast Growth Factor (Gibco)] unless otherwise noted ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 μL/sample of recombinant Protein-G-Sepharose-4B beads (ThermoFisher) was washed thrice with IP buffer and added to each sample for equilibration on a rotator for 4h ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.25 and 1 ng/ul human recombinant FGF8 (Thermofisher scientific, # PHG0184) diluted in E2 media by immersion starting at 18hpf ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant proteins were produced using the Expi293F cells (Thermo Fisher Scientific) by transfecting 200×106 of these cells with purified DNA using the ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant ACE2-Fc (18-615) protein expressed in Expi293F (Life Technologies) cells was chemically biotinylated using EZ-link Sulfo-NHS-Biotin (A39256 ...
-
bioRxiv - Microbiology 2020Quote: ... The recombinant sACE2 protein was purified by nickel affinity columns (Invitrogen) and ACE2-Fc was purified using Protein A affinity column (Cytiva) ...
-
bioRxiv - Bioengineering 2021Quote: ... human recombinant insulin (10 μg ml-1, Life Technologies, 12585-014), IGF-2 (30 ng ml-1 ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant mAbs were then produced in EXPi293F cells (Life Technologies, USA) by transfecting pairs of the IgG1 heavy and light chain expression plasmids ...
-
bioRxiv - Immunology 2021Quote: ... with 17 ng/ml of recombinant human IL-2 (ThermoFisher Scientific). MART-1-specific CD8+ T-cell clones were generated by Friedmann et al (Friedmann et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The full Delta-Omicron recombinant spike was cloned into pcDNA6 (Invitrogen). Point mutations were introduced by overlap extension PCR ...
-
bioRxiv - Molecular Biology 2023Quote: All PCRs were performed by using Recombinant Taq polymerase (Thermo Scientific). 100 ng of the synthesized DNA was mixed with 1X PCR buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... or 20mg/mL proteinase K (recombinant PCR grade, ThermoFisher Cat# EO0492) for 10 ...
-
bioRxiv - Neuroscience 2022Quote: ... and recombinant rabbit monoclonal anti-LUM (Lumican, Invitrogen Cat#MA5-29402). The samples were subsequently digitized using a NanoZoomer Hamamatsu S60 digital slide scanner.
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Biochemistry 2022Quote: All recombinant proteins were expressed in Escherichia coli BL21 DE3 (Invitrogen), in LB medium ...
-
bioRxiv - Immunology 2023Quote: Recombinant gp120s were produced via transient transfection using Freestyle 293F (ThermoFisher) or 293S GnT1- cells and 293Fectin using the same conditions as SOSIP gp140s ...
-
bioRxiv - Developmental Biology 2023Quote: ... 50 ng/ml recombinant human epidermal growth factor (Invitrogen, Waltham, MA), and 5 μg/ml of follicle-stimulating hormone (Bioniche Animal Health ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 ng/ml human recombinant epidermal growth factor (Fisher Scientific PHG0311), 5 mM glucose (Fisher Scientific A2494001) ...
-
bioRxiv - Immunology 2023Quote: ... TotAZsk6 embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting TotX coding sequence (GTTCAAGTTATGAGGAACACAGG) ...
-
bioRxiv - Immunology 2023Quote: Recombinant mAbs were transiently produced in FreeStyle 293F cells (ThermoFisher Scientific) following the protocol detailed by Vink et al (Vink ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 units/ml RNaseOUT Recombinant Ribonuclease Inhibitor (#10777019; Thermo Fisher Scientific); 0.5 mm Spermidine (#S2626 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 ng/mL human EGF recombinant protein (Life Technologies, Cat: PHG0311), and 100 IU/mL P/S ...
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Immunology 2023Quote: ... wiso embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting the TotM coding sequence (ACTTATCGTAGAAAGTGACCAGG ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... VEGF ligand (recombinant human protein) was ordered from ThermoFisher (CAT: #PHC9391).
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/uL human IL-6 recombinant protein (ThermoFisher PHC0066).
-
bioRxiv - Cell Biology 2023Quote: ... recombinant bacmid DNA was generated in DH10Bac cells (Thermo Fisher 10361012), and isolated bacmid DNA was transfected into Sf9 cells (a gift from Yifan Cheng ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant polyclonal anti-ALDOA antibody cocktail (711764) was purchased from Invitrogen. Goat polyclonal anti-PDGFRβ (sc-1627) ...
-
bioRxiv - Immunology 2024Quote: ... injections also contained 1 μg of recombinant murine IL-2 (Gibco). PBS was used as vehicle.
-
bioRxiv - Immunology 2024Quote: ... used for recombinant protein production were maintained in FreeStyle (ThermoFisher, #12338026) or Expi293 media (ThermoFisher ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Staining with DYKDDDDK Tag Recombinant Rabbit Monoclonal Antibody (8H8L17, Invitrogen, 701629) at 1:500 dilution was performed in blocking solution at 4℃ for 14 hours ...
-
bioRxiv - Microbiology 2024Quote: ... Treatment with recombinant 10 U/mL human IFNγ (ThermoFisher Scientific RIFNG100) was done at 24 hours post-infection ...
-
bioRxiv - Bioengineering 2024Quote: ... 5250 ng/mL human recombinant IL-6 protein (Invitrogen; Waltham, MA) was added to the experimental group and an equal volume of 1X PBS was added to the control group ...
-
bioRxiv - Synthetic Biology 2023Quote: All recombinant proteins were produced in Expi293F cells (Thermo Fisher Scientific) by transient transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant murine pro-CtsK were expressed in 293-Freestyle cells (ThermoFisher) by transient expression using FectoPRO transfection reagent (Polyplus transfection) ...
-
bioRxiv - Biophysics 2024Quote: ... The recombinant DR2539 was expressed in Escherichia coli BL21 (DE3) (Invitrogen). The cells were grown at 310 K to an OD600 of ≈ 0.6 in Luria-Bertani medium containing 100 µg ml-1 of ampicillin ...
-
bioRxiv - Immunology 2024Quote: ... Recombinant proteins were diluted in DPBS (Life technologies cat. # 14040-182) (tetNA was diluted to 0.5 µg/ml) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Sybr Safe DNA gel stain and BenchMark™ His-tagged Protein Standard were purchased from Invitrogen. HRP-conjugated 6*His His-Tag Mouse McAB was obtained from Proteintech ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... His-tagged proteins were eluted from the beads in a disposable polypropylene column (29924, ThermoFisher Scientific) using elution buffer (4 ml wash buffer containing 400 mM imidazole ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... T0M20 antibodies (polyclonal, cat number PA5-52843) and Alexa 568-tagged secondary antibodies were from ThermoFisher. The imaging was performed using Nikon SP-1 microscope and analyzed using FIJI (Schindelin et al. ...
-
bioRxiv - Cell Biology 2019Quote: Creation of the 3xmEGFP tagged RabE12 construct occurred by a two-element LR Gateway reaction (ThermoFisher) of entry clones pENT-L1-3xmEGFP-L5r and pENT-L5-RabE12-L2 ...
-
bioRxiv - Neuroscience 2020Quote: ... N-terminally HA-tagged AMPAR constructs were expressed from the doxycycline inducible pcDNA4/TO vector (Invitrogen Cat ...
-
bioRxiv - Biochemistry 2021Quote: Immunoprecipitation of HA tagged GAPDH (TDH3-HA) was performed using Pierce anti-HA beads (Thermo Fisher). Briefly ...
-
bioRxiv - Biochemistry 2021Quote: ... 200 μl and the tagged Aβ(1-40) is incubated with Ulp1 SUMO-protease (either Invitrogen or produced recombinantly (Malakhov ...
-
bioRxiv - Neuroscience 2020Quote: ... media was collected and His tagged proteins were bound using HisPur Ni-NTA Resin (ThermoFisher; 88221) in the presence of Calbiochem’s EDTA-free protease inhibitor cocktail 1:1000 (MilliporeSigma ...
-
bioRxiv - Biophysics 2021Quote: ... they were transfected with EGFP tagged wt LA/A350P DNA along with Lipofectamine 2000 (Invitrogen, USA) in a ratio 1:1.5 ...
-
bioRxiv - Plant Biology 2022Quote: ... His-tagged ChElp2 was pulled-down with Dynabeads™ His-Tag (Thermo Fisher Scientific, Massachusetts, USA) and the subsequent western blot analyses were performed with anti-His (Sigma ...