Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for Recombinant Human Ribulose 5 Phosphate 3 Epimerase His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... and 20 ng/mL thermostable recombinant human Fibroblast Growth Factor (Gibco)] unless otherwise noted ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.25 and 1 ng/ul human recombinant FGF8 (Thermofisher scientific, # PHG0184) diluted in E2 media by immersion starting at 18hpf ...
-
bioRxiv - Bioengineering 2021Quote: ... human recombinant insulin (10 μg ml-1, Life Technologies, 12585-014), IGF-2 (30 ng ml-1 ...
-
bioRxiv - Immunology 2021Quote: ... with 17 ng/ml of recombinant human IL-2 (ThermoFisher Scientific). MART-1-specific CD8+ T-cell clones were generated by Friedmann et al (Friedmann et al. ...
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Developmental Biology 2023Quote: ... 50 ng/ml recombinant human epidermal growth factor (Invitrogen, Waltham, MA), and 5 μg/ml of follicle-stimulating hormone (Bioniche Animal Health ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 ng/ml human recombinant epidermal growth factor (Fisher Scientific PHG0311), 5 mM glucose (Fisher Scientific A2494001) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 ng/mL human EGF recombinant protein (Life Technologies, Cat: PHG0311), and 100 IU/mL P/S ...
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... VEGF ligand (recombinant human protein) was ordered from ThermoFisher (CAT: #PHC9391).
-
bioRxiv - Microbiology 2024Quote: ... Treatment with recombinant 10 U/mL human IFNγ (ThermoFisher Scientific RIFNG100) was done at 24 hours post-infection ...
-
bioRxiv - Bioengineering 2024Quote: ... 5250 ng/mL human recombinant IL-6 protein (Invitrogen; Waltham, MA) was added to the experimental group and an equal volume of 1X PBS was added to the control group ...
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
bioRxiv - Cell Biology 2019Quote: ... PKC-specific custom siRNA targeting to endogenous human PKCα (5’-CAGAAGAACTGTATGCAAT-3’) was purchased from Ambien (ThermoFisher). To perform knockdowns ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-CAGAGTCGATCAGTCTGCATATCTCCA-3’) with the dilution protocol of the Phusion Human Specimen Direct PCR Kit (Thermo Scientific). The PCR product was sequenced directly with a nested sequencing primer (5’-GGTGCTCTCCCGGGTACACAA-3’) ...
-
bioRxiv - Microbiology 2024Quote: ... Plates were washed five times with PBS and then twice with distilled water (dH2O) before addition of 5-bromo-4-chloro-3-indolyl-phosphate/NBT (BCIP/NBT) one-step solution (Thermo Fisher Scientific) and incubation at 37°C for approximately 15 minutes ...
-
bioRxiv - Developmental Biology 2021Quote: ... ESCs were dissociated with TrypLE Express for 5 mins at 37°C and induced into EpiLCs by addition of human recombinant basic fibroblast growth factor (bFGF) (Invitrogen, 13256-029) and activin A (Peprotech ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mL of Phosphate-Buffered Saline (PBS; Gibco, ThermoFisher Scientific) was added to reduce viscosity ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mL of Phosphate-Buffered Saline (PBS; Gibco, ThermoFisher Scientific) was added to reduce viscosity ...
-
bioRxiv - Biochemistry 2020Quote: ... The expression of the recombinant protein was measured by ELISA using anti‐His tag monoclonal antibody (Invitrogen) to capture and biotinylated anti‐ANG1 antibody for detection (R&D System) ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant AtCSD1 protein containing a 6xHis-tag was purified using Dynabeads His-Tag (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: Recombinant Rep1ΔAD-His and its variants were incubated with 50 μl D–Galactose agarose beads (Thermo Scientific) overnight at 4 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1.0 mg/mL recombinant human insulin, 0.55 mg/mL human transferrin, 0.67 μg/mL sodium selenite, Gibco), and 0.04 μg/mL dexamethasone (Sigma Aldrich) ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Bruner and Siliciano, 2018), env (Forward: 5’-AGTGGTGCAGAGAGAAAAAAGAGC-3’, Reverse: 5’-GTCTGGCCTGTACCGTCAGC-3’, Probe: 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB) (Thermo Fisher Scientific) (Bruner et al. ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Palmer et al., 2003) and pol (Forward: 5’-GCACTTTAAATTTTCCCATTAGTCCTA-3’, Reverse: 5’-CAAATTTCTACTAATGCTTTTATTTTTTC-3’, Probe: 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB) (Thermo Fisher Scientific) (Schmid et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Molecular Biology 2020Quote: 6xHis-tagged REV-ERBβ LBD (4 nM) was incubated with anti-His antibody conjugated to terbium (1 nM) (ThermoFisher #PV5863) and FITC-labeled NCoR ID1 or NCoR ID2 peptide (400 nM ...
-
bioRxiv - Bioengineering 2022Quote: ... supernatants were harvested and filtered with a 0.22 µm membrane.The His-tagged proteins were purified with the HisPur Ni- NTA Resin (Thermo Fisher, 88222). After three columns of washing with 25 mM Imidazole (pH 7.4) ...
-
bioRxiv - Cell Biology 2019Quote: ... 1-2 μg His-tagged calcineurin was first bound to Ni-NTA-agarose or magnetic Dynabeads (Thermo Fisher Sci. USA) in base buffer (50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Biochemistry 2019Quote: ... mCherry-(backbone pLV-CMV-bc) and FLAG-His-tagged(backbone Pcdna3) p16INK4A constructs were created using gateway technology (Life Technologies). For cell cycle profiling ...
-
bioRxiv - Bioengineering 2021Quote: ... supernatants were harvested and filtered with a 0.22 μm membrane.The His-tagged proteins were purified with the HisPur Ni-NTA Resin (Thermo Fisher, 88222). After three columns of washing with 25 mM Imidazole (pH 7.4) ...
-
bioRxiv - Cell Biology 2022Quote: His- and GST-tagged CFAP418 proteins were expressed in One Shot™ BL21 Star™ (DE3) cells (ThermoFisher, Waltham, MA) and purified using HisPur™ Ni-NTA resin and Pierce™ Glutathione Superflow Agarose ...
-
bioRxiv - Cell Biology 2019Quote: ... Infected Sf9 cells were grown in spinner culture for 48–96 h at 27°C and His-tagged protein-purified using Ni2+-NTA agarose (Invitrogen) according to standard procedures ...
-
bioRxiv - Molecular Biology 2020Quote: Plasmid encoding the N-terminally His-tagged Msm HelD protein was prepared by the GeneArt® Plasmid Construction Service (Thermofisher). Gene construct for HelD expression was designed by codon-optimized back translation of gene MSMEG_2174 from Msm (strain ATCC 700084 / mc2 155 ...
-
bioRxiv - Microbiology 2020Quote: ... The His-tagged protein was purified from the cleared cell lysate by nickel affinity chromatography (Ni-NTA agarose beads, Invitrogen). After washing with increasing concentrations of imidazole ...
-
bioRxiv - Microbiology 2022Quote: ... and P323L/G671S N-terminally tagged with 6×His were purified using Bac-to-Bac™ Baculovirus Expression System based on the manufacturer’s instruction (Gibco). Upon 3 dpi of NSP12-enconding baculoviruses into Sf9 cells ...
-
bioRxiv - Plant Biology 2023Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... washed 3 x 5 min with PBS and incubated with Alexa Fluor-488 goat anti human secondary (Invitrogen) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3) phosphate buffered saline (PBS, pH 7.2; Thermo Fisher Scientific-Gibco 20012027) at 50°C without added MgCl2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3) phosphate buffered saline (PBS, pH 7.2; Thermo Fisher Scientific-Gibco 20012027) at 50°C without added MgCl2 ...
-
bioRxiv - Bioengineering 2022Quote: ... HUVECs (passages 3-7) were washed with phosphate-buffered saline (PBS, ThermoFisher) and detached by trypsin/EDTA solution (ThermoFisher) ...
-
bioRxiv - Physiology 2023Quote: ... mouse anti-Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:50000, Thermo Fisher, AM4300), mouse anti-CASQ1 (1:5000 ...
-
bioRxiv - Neuroscience 2019Quote: ... and 20 ng/mL recombinant human fibroblast growth factor-basic (Life Technologies). After 3 to 6 weeks ...
-
bioRxiv - Microbiology 2021Quote: ... 20 ng/ml of recombinant human epidermal growth factor (EGF, Life Technologies), human insulin (Sigma) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 10 ng/ml bFGF recombinant human protein (Thermo Fisher Scientific, USA). From day 6 until day 12 the medium was changed once in two days with the addition of 1 mM valproic acid (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... Human recombinant epidermal growth factor (hEGF) protein was purchased from Life Technologies and dissolved in PBS ...