Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for Recombinant Human Interleukin 22 Receptor Alpha 2 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... pre-treated cover glasses (22×22×1; Fisher Scientific. # 12-542B), fixed ...
-
bioRxiv - Neuroscience 2022Quote: ... 1.5 22 × 22 mm coverslips (Fisher Scientific, catalog no. 12-541B). The spacers were superglued to the microscope slide on both sides of the neuron-adhered coverslip ...
-
bioRxiv - Bioengineering 2022Quote: ... 1.5 22 × 22 mm coverslips (Fisher Scientific, catalog no. 12-541B) (cells ...
-
bioRxiv - Molecular Biology 2020Quote: 6xHis-tagged REV-ERBβ LBD (4 nM) was incubated with anti-His antibody conjugated to terbium (1 nM) (ThermoFisher #PV5863) and FITC-labeled NCoR ID1 or NCoR ID2 peptide (400 nM ...
-
bioRxiv - Bioengineering 2022Quote: ... supernatants were harvested and filtered with a 0.22 µm membrane.The His-tagged proteins were purified with the HisPur Ni- NTA Resin (Thermo Fisher, 88222). After three columns of washing with 25 mM Imidazole (pH 7.4) ...
-
bioRxiv - Biochemistry 2019Quote: ... mCherry-(backbone pLV-CMV-bc) and FLAG-His-tagged(backbone Pcdna3) p16INK4A constructs were created using gateway technology (Life Technologies). For cell cycle profiling ...
-
bioRxiv - Bioengineering 2021Quote: ... supernatants were harvested and filtered with a 0.22 μm membrane.The His-tagged proteins were purified with the HisPur Ni-NTA Resin (Thermo Fisher, 88222). After three columns of washing with 25 mM Imidazole (pH 7.4) ...
-
bioRxiv - Cell Biology 2022Quote: His- and GST-tagged CFAP418 proteins were expressed in One Shot™ BL21 Star™ (DE3) cells (ThermoFisher, Waltham, MA) and purified using HisPur™ Ni-NTA resin and Pierce™ Glutathione Superflow Agarose ...
-
bioRxiv - Cell Biology 2019Quote: ... Infected Sf9 cells were grown in spinner culture for 48–96 h at 27°C and His-tagged protein-purified using Ni2+-NTA agarose (Invitrogen) according to standard procedures ...
-
bioRxiv - Molecular Biology 2020Quote: Plasmid encoding the N-terminally His-tagged Msm HelD protein was prepared by the GeneArt® Plasmid Construction Service (Thermofisher). Gene construct for HelD expression was designed by codon-optimized back translation of gene MSMEG_2174 from Msm (strain ATCC 700084 / mc2 155 ...
-
bioRxiv - Microbiology 2020Quote: ... The His-tagged protein was purified from the cleared cell lysate by nickel affinity chromatography (Ni-NTA agarose beads, Invitrogen). After washing with increasing concentrations of imidazole ...
-
bioRxiv - Microbiology 2022Quote: ... and P323L/G671S N-terminally tagged with 6×His were purified using Bac-to-Bac™ Baculovirus Expression System based on the manufacturer’s instruction (Gibco). Upon 3 dpi of NSP12-enconding baculoviruses into Sf9 cells ...
-
bioRxiv - Microbiology 2020Quote: ... To starve Chlamydia of tryptophan HeLa cells were incubated for 24 h in media containing 2 ng/ml recombinant human IFN-γ (Invitrogen: PHC4033) prior to infection ...
-
bioRxiv - Immunology 2023Quote: ... recombinant SARS-CoV-2 S protein (RP-87680, Invitrogen) or recombinant SARS-CoV-2 spike RBD protein (40592-V08H ...
-
bioRxiv - Immunology 2024Quote: ... The cells were then washed in PBS and stained with a mix of secondary antibodies anti-human IgG-Fc-AF647 (1:600) and anti-human IgA-Alpha-Chain-AF488 (1:200) (Thermo Fisher Scientific) for 30 min at 4°C ...
-
bioRxiv - Immunology 2020Quote: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax ...
-
bioRxiv - Neuroscience 2021Quote: ... and further digested for 5 min at room temperature (22°C) using a TrypLE Express recombinant protease (ThermoFisher Scientific, cat. #12605010). The dissociated cells were sedimented by centrifugation (900 g for 10 min at 4°C) ...
-
bioRxiv - Physiology 2021Quote: ... transferred and blotted with Peroxisome proliferator-activated receptor alpha (PPARα, ab 215270), endothelial nitric oxide synthase (eNOS, sc-376751) and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH, Thermo Fisher, #10941-1-AP) antibodies as described [65] ...
-
bioRxiv - Neuroscience 2019Quote: ... and 20 ng/mL recombinant human fibroblast growth factor-basic (Life Technologies). After 3 to 6 weeks ...
-
bioRxiv - Microbiology 2021Quote: ... 20 ng/ml of recombinant human epidermal growth factor (EGF, Life Technologies), human insulin (Sigma) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 10 ng/ml bFGF recombinant human protein (Thermo Fisher Scientific, USA). From day 6 until day 12 the medium was changed once in two days with the addition of 1 mM valproic acid (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... Human recombinant epidermal growth factor (hEGF) protein was purchased from Life Technologies and dissolved in PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... 10 ng/ml recombinant human basic fibroblast growth factor (Invitrogen, Waltham, MA) (hiPSC medium).
-
bioRxiv - Physiology 2020Quote: ... and 2.5 ng/ml recombinant human hepatocyte growth factor (Gibco, Loughborough, UK). Skeletal muscle myoblasts were incubated at 37°C in a humidified atmosphere of 5% CO2 until 80% confluence ...
-
bioRxiv - Cell Biology 2020Quote: ... The recombinant human EGF used in this study was from Thermo Fisher Scientific and the recombinant human HGF was generously provided by Drs ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μg of FGFb Recombinant Human Protein and 1% Gluta-MaxTM (Gibco) in flasks coated with Matrigel Matrix Basement Membrane (Corning ...
-
bioRxiv - Developmental Biology 2022Quote: ... 10 ng/mL Human TGF-β 1 recombinant protein (Cat# PHG9204, Gibco) and 1 μg/mL L-Ascorbic acid 2-phosphate (Cat# A8960 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... on plates coated with recombinant human collagen I (Coating Matrix kit, Gibco) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng/mL human recombinant GM-CSF (Thermo Fisher Scientific, USA) at 37 °C and 5 % carbon dioxide ...
-
bioRxiv - Cell Biology 2023Quote: ... Human recombinant plasminogen activator inhibitor 1 (PAI-1) was from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng/mL human recombinant GM-CSF (Thermo Fisher Scientific, USA). The incubator condition was set at 37 °C with 5 % carbon dioxide environment ...
-
bioRxiv - Immunology 2023Quote: ... Recombinant human IFN-β (1000 U/ml to 1 U/ml, ThermoFisher) was used as positive controls for IRF activation ...
-
bioRxiv - Cancer Biology 2023Quote: ... human recombinant EGF (10 ng/ml) (Thermo Fisher Scientific, Waltham, MA, USA), D-glucose (5.5 mM ...
-
bioRxiv - Cancer Biology 2023Quote: ... bovine pituitary extract and human recombinant epidermal growth factor (Gibco, 37000-015)) and primary gingival keratinocyte (Dermal cell basal medium (ATCC ...
-
bioRxiv - Cell Biology 2023Quote: ... hiPSCs were cultured on human recombinant vitronectin in StemFlexTM media (Life Technologies) and differentiation was initiated by plating singularised hiPSCs on human embryonic stem cells (hESC)-qualified Matrigel (Corning ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 % FBS and 200 ng/mL Human M-CSF Recombinant Protein (ThermoFisher). Six days after the initial isolation ...
-
bioRxiv - Cell Biology 2023Quote: Pooled HUVEC sample sets were grown to confluence before treatment with or without recombinant tumour necrosis factor alpha (TNF; 10 ng/mL) (ThermoFisher) in cell culture medium ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Plant Biology 2023Quote: ... alpha Tubulin monoclonal primary antibody (YL1/2) (1:10,000; Thermo Scientific MA1-80017) and goat anti-rat IgG secondary antibody (1:10,000 ...
-
bioRxiv - Pathology 2020Quote: ... 4-μm human archival melanoma sample sections collected on plus slides (Fisher Scientific, Cat# 22-042-924) and stored at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Human MSCs were cultured in alpha Modification of Eagle’s minimal essential medium (αMEM) (Thermo Fisher Scientific) supplemented with 15% FBS (Gemini Bio-Products) ...
-
bioRxiv - Genetics 2023Quote: ... androgen receptor (Invitrogen), PTK2 (Invitrogen) ...
-
bioRxiv - Immunology 2023Quote: The DNA coding sequences of tagged recombinant GITRL and OX40L were produced by GeneArt Gene Synthesis service (ThermoFisher Scientific). The sequences of GITRL and OX40L constructs contain ...
-
bioRxiv - Neuroscience 2021Quote: HEK cells were grown on 22×22 mm coverslips (Thermofisher scientific, MA) or 35 mm imaging plates (MaTek ...
-
bioRxiv - Bioengineering 2022Quote: ... and vascular endothelial growth factor receptor 2 (VEGFR-2, Catalog No. PA5-16487, Thermo Fisher Scientific, Waltham, MA). For sections being stained for a target antigen ...
-
bioRxiv - Bioengineering 2020Quote: ... were cultured in alpha minimum essential media (alpha-MEM, Invitrogen) supplemented with 15% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2023Quote: ... 1-2 μl of primary anti-His (PA1-983B, Thermo Scientific) or anti-alpha RNAP (4RA2 ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µL of Novex Hi-Density TBE 5X Sample Buffer (Invitrogen) was mixed with 8 µL of the completed EMSA reaction and loaded on an 8% acrylamide gel ...
-
bioRxiv - Bioengineering 2021Quote: ... [22] using Lipofectamine2000 (Invitrogen) as a transfection agent ...
-
bioRxiv - Systems Biology 2021Quote: ... 22 µL PrestoBlue (ThermoFisher) cell viability reagent was added to each well and plates were resealed and returned to the incubator for 1 hour ...