Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for Recombinant Human Interleukin 2 Receptor Alpha His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... with 0.1 ng/mL human recombinant epidermal growth factor (EGF; Gibco) and 0.05 mg/ml bovine pituitary extract (Gibco ...
-
bioRxiv - Neuroscience 2020Quote: ... and human recombinant insulin (2.5 µg/mL, Thermo Fisher Scientific, 12585014). From Day 1 to 11 ...
-
bioRxiv - Biochemistry 2020Quote: ... Full-length recombinant human LRRK2[G2019S] was purchased from Invitrogen (#A15202). GZD-824 was purchased from Cayman Chemical (#21508 ...
-
bioRxiv - Pathology 2019Quote: ... CSF-1 Recombinant Human Protein (25ng/mL, Thermo Fisher Scientific PHC9504), and Recombinant Human TGF-β1 (50ng/mL ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 ng/mL of human recombinant epidermal growth factor (Invitrogen PHG0313), 10 ng/mL of basic fibroblast growth factor (Invitrogen PHG0263 ...
-
bioRxiv - Microbiology 2020Quote: Recombinant human mAbs were expressed in Expi293 HEK cells (Life Technologies), which were maintained in suspension at 37°C and 8% CO2 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1% human recombinant insulin and zinc solution (Gibco, 12585-014). On day 3 ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant human (h) PF4 was expressed in Drosophila Expression System (Invitrogen) S2 cells and purified as described22 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 50 ng/mL recombinant human EGF (Thermo Fisher Scientific, Waltham, MA), 0.1 mM N-acetyl-L-cysteine (Sigma ...
-
bioRxiv - Biochemistry 2020Quote: ... supplemented with 2.5 μg / 500 mL EGF recombinant human protein (Gibco) and 1% penicillin and streptomycin (Wisent ...
-
bioRxiv - Neuroscience 2021Quote: ... and 20 ng/mL thermostable recombinant human Fibroblast Growth Factor (Gibco)] unless otherwise noted ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.25 and 1 ng/ul human recombinant FGF8 (Thermofisher scientific, # PHG0184) diluted in E2 media by immersion starting at 18hpf ...
-
bioRxiv - Bioengineering 2021Quote: ... human recombinant insulin (10 μg ml-1, Life Technologies, 12585-014), IGF-2 (30 ng ml-1 ...
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Developmental Biology 2023Quote: ... 50 ng/ml recombinant human epidermal growth factor (Invitrogen, Waltham, MA), and 5 μg/ml of follicle-stimulating hormone (Bioniche Animal Health ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 ng/ml human recombinant epidermal growth factor (Fisher Scientific PHG0311), 5 mM glucose (Fisher Scientific A2494001) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 ng/mL human EGF recombinant protein (Life Technologies, Cat: PHG0311), and 100 IU/mL P/S ...
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... VEGF ligand (recombinant human protein) was ordered from ThermoFisher (CAT: #PHC9391).
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/uL human IL-6 recombinant protein (ThermoFisher PHC0066).
-
bioRxiv - Microbiology 2024Quote: ... Treatment with recombinant 10 U/mL human IFNγ (ThermoFisher Scientific RIFNG100) was done at 24 hours post-infection ...
-
bioRxiv - Bioengineering 2024Quote: ... 5250 ng/mL human recombinant IL-6 protein (Invitrogen; Waltham, MA) was added to the experimental group and an equal volume of 1X PBS was added to the control group ...
-
bioRxiv - Immunology 2021Quote: Purified CD8+ cells were cultured in AIMV medium supplemented with 10% FBS and 100 U/ml recombinant human IL-2 (ThermoFisher Scientific) and used for sorting of CD8+ T cell subsets and for further experiments three days after isolation.
-
Pathogenic CD8 T cell responses are driven by neutrophil-mediated hypoxia in cutaneous leishmaniasisbioRxiv - Immunology 2023Quote: ... 20 U/mL recombinant human IL-2 at 37°C and 5% CO2 for 24 hours in RPMI 1640 (Gibco, Canada) containing 100 Units of penicillin and 0.1 mg/mL of Streptomycin (Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Human V1A Receptor-CHO cell line (CHO -V1a) was cultured in Ham’s F12 (Life Technologies) supplemented with 10% fetal bovine serum (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cells were stained with human FITC conjugated transferrin receptor (CD71; ThermoFisher: 11-0719-42) and human FITC conjugated glycophorin A (CD235a ...
-
bioRxiv - Biophysics 2022Quote: ... primary antibody: anti-Tubulin alpha-Tubulin clone YL1/2 (Thermo Fisher Scientific) used in a dilution 1 in 200 ...
-
bioRxiv - Pathology 2021Quote: ... Detailed immunohistochemistry staining and quantification procedures for each marker have been published (6, 16–26) or are in preparation for estrogen receptor alpha (antibody SP1; Thermo Scientific, Waltham, MA) and an antibody (PPG5/10 ...
-
bioRxiv - Neuroscience 2020Quote: ... cells resuspended in 500µl 2% HI-FBS + PBS (ThermoFisher 12484028), and passed through a 40µm nylon mesh cell strainer (FisherScientific 352235) ...
-
bioRxiv - Microbiology 2023Quote: Interleukin-6 (IL-6)_ and interleukin-12 (IL-12_ expression levels were detected by ELISA Kits (Thermo Fisher Scientific, USA); the samples analysed via ELISA were either plasma drawn from mice or cell culture supernatants ...
-
bioRxiv - Biochemistry 2020Quote: ... The expression of the recombinant protein was measured by ELISA using anti‐His tag monoclonal antibody (Invitrogen) to capture and biotinylated anti‐ANG1 antibody for detection (R&D System) ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant AtCSD1 protein containing a 6xHis-tag was purified using Dynabeads His-Tag (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: Recombinant Rep1ΔAD-His and its variants were incubated with 50 μl D–Galactose agarose beads (Thermo Scientific) overnight at 4 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1.0 mg/mL recombinant human insulin, 0.55 mg/mL human transferrin, 0.67 μg/mL sodium selenite, Gibco), and 0.04 μg/mL dexamethasone (Sigma Aldrich) ...
-
bioRxiv - Immunology 2021Quote: ... mouse interleukin 6 (IL-6; ThermoFisher; 1:500). Sections were then stained for DAPI (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: 6xHis-tagged REV-ERBβ LBD (4 nM) was incubated with anti-His antibody conjugated to terbium (1 nM) (ThermoFisher #PV5863) and FITC-labeled NCoR ID1 or NCoR ID2 peptide (400 nM ...
-
bioRxiv - Bioengineering 2022Quote: ... supernatants were harvested and filtered with a 0.22 µm membrane.The His-tagged proteins were purified with the HisPur Ni- NTA Resin (Thermo Fisher, 88222). After three columns of washing with 25 mM Imidazole (pH 7.4) ...
-
bioRxiv - Biochemistry 2019Quote: ... mCherry-(backbone pLV-CMV-bc) and FLAG-His-tagged(backbone Pcdna3) p16INK4A constructs were created using gateway technology (Life Technologies). For cell cycle profiling ...
-
bioRxiv - Bioengineering 2021Quote: ... supernatants were harvested and filtered with a 0.22 μm membrane.The His-tagged proteins were purified with the HisPur Ni-NTA Resin (Thermo Fisher, 88222). After three columns of washing with 25 mM Imidazole (pH 7.4) ...
-
bioRxiv - Cell Biology 2022Quote: His- and GST-tagged CFAP418 proteins were expressed in One Shot™ BL21 Star™ (DE3) cells (ThermoFisher, Waltham, MA) and purified using HisPur™ Ni-NTA resin and Pierce™ Glutathione Superflow Agarose ...
-
bioRxiv - Cell Biology 2019Quote: ... Infected Sf9 cells were grown in spinner culture for 48–96 h at 27°C and His-tagged protein-purified using Ni2+-NTA agarose (Invitrogen) according to standard procedures ...
-
bioRxiv - Molecular Biology 2020Quote: Plasmid encoding the N-terminally His-tagged Msm HelD protein was prepared by the GeneArt® Plasmid Construction Service (Thermofisher). Gene construct for HelD expression was designed by codon-optimized back translation of gene MSMEG_2174 from Msm (strain ATCC 700084 / mc2 155 ...
-
bioRxiv - Microbiology 2020Quote: ... The His-tagged protein was purified from the cleared cell lysate by nickel affinity chromatography (Ni-NTA agarose beads, Invitrogen). After washing with increasing concentrations of imidazole ...
-
bioRxiv - Microbiology 2022Quote: ... and P323L/G671S N-terminally tagged with 6×His were purified using Bac-to-Bac™ Baculovirus Expression System based on the manufacturer’s instruction (Gibco). Upon 3 dpi of NSP12-enconding baculoviruses into Sf9 cells ...
-
bioRxiv - Microbiology 2020Quote: ... To starve Chlamydia of tryptophan HeLa cells were incubated for 24 h in media containing 2 ng/ml recombinant human IFN-γ (Invitrogen: PHC4033) prior to infection ...
-
bioRxiv - Immunology 2023Quote: ... recombinant SARS-CoV-2 S protein (RP-87680, Invitrogen) or recombinant SARS-CoV-2 spike RBD protein (40592-V08H ...
-
bioRxiv - Immunology 2024Quote: ... The cells were then washed in PBS and stained with a mix of secondary antibodies anti-human IgG-Fc-AF647 (1:600) and anti-human IgA-Alpha-Chain-AF488 (1:200) (Thermo Fisher Scientific) for 30 min at 4°C ...
-
bioRxiv - Immunology 2020Quote: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax ...
-
bioRxiv - Physiology 2021Quote: ... transferred and blotted with Peroxisome proliferator-activated receptor alpha (PPARα, ab 215270), endothelial nitric oxide synthase (eNOS, sc-376751) and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH, Thermo Fisher, #10941-1-AP) antibodies as described [65] ...
-
bioRxiv - Neuroscience 2019Quote: ... and 20 ng/mL recombinant human fibroblast growth factor-basic (Life Technologies). After 3 to 6 weeks ...