Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Recombinant Bovine ICAM1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... and Icam1 (10ug/mL; Invitrogen). In order to detect the Icam1 signal ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were washed twice and ICAM1 was stained using an anti-ICAM1 PE (#MHCD5404-4, Invitrogen) antibody ...
-
bioRxiv - Cancer Biology 2021Quote: ... anti-ICAM1 (Thermo Fisher Scientific, MA5407), and anti-S100A10 (Novus Biologicals ...
-
bioRxiv - Physiology 2022Quote: ... and ICAM1 (16-0541-81, Invitrogen), β-actin (4970 ...
-
bioRxiv - Systems Biology 2024Quote: ... EGF Recombinant Human Protein (Gibco #PHG0313), FGF Basic (aa 10 155 ...
-
bioRxiv - Bioengineering 2020Quote: ... 1.61 nM EGF Recombinant Human Protein (Invitrogen), 0.178 mM Adenine (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: ... Recombinant LRRK2 protein was from ThermoFisher (#A15197). For pT73 Rab10 assay ...
-
bioRxiv - Developmental Biology 2021Quote: ... G-CSF Recombinant Human Protein (Thermo fisher), IP injection ...
-
bioRxiv - Cancer Biology 2020Quote: ... Canada and maintained in keratinocyte serum-free media supplemented with 0.05 mg/ml of bovine pituitary extract and 0.02 μg/ml EGF recombinant human protein (Life Technologies, Benicia, CA) in a 37°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... BMP2 recombinant human protein (Thermo Fisher Scientific, #PHC7145) was applied for 1h on cells ...
-
bioRxiv - Neuroscience 2020Quote: ... Recombinant full-length human G2019S-LRRK2 protein (Invitrogen) was used as a protein standard ...
-
bioRxiv - Neuroscience 2020Quote: ... GS or DA recombinant proteins (970-2527aa) (Thermofisher), GST-AAK1 (1-501aa ...
-
bioRxiv - Bioengineering 2022Quote: ... Human BMP-4 Recombinant Protein (Gibco, Catalog # PHC9534). For cell culture of iPSCs on niches ...
-
bioRxiv - Cancer Biology 2022Quote: ... IL-8 Monocyte Recombinant Human Protein (ThermoFisher, PHC0884), and Recombinant Human CXCL1/GROα Protein (R&D Systems ...
-
bioRxiv - Cell Biology 2022Quote: ... Vitronectin (recombinant human protein) was from Fisher Scientific.
-
bioRxiv - Immunology 2021Quote: ... Recombinant proteins were produced in Expi293F cells (ThermoFisher) by transfection with purified DNA using the ExpiFectamine 293 Transfection Kit (ThermoFisher) ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant proteins were coated in PBS buffer (Gibco) at the concentration of 1.2 mg/ml of protein per well ...
-
bioRxiv - Immunology 2022Quote: ... Recombinant proteins were produced in Expi293F cells (ThermoFisher) by transfection with purified DNA using the ExpiFectamine 293 Transfection Kit (ThermoFisher) ...
-
bioRxiv - Bioengineering 2022Quote: ... and BMP4 recombinant protein (Gibco; 5 ng/mL). The media was half-changed every day during the differentiation process ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant proteins were produced in Expi293F cells (ThermoFisher) by transfection of DNA using the ExpiFectamine 293 Transfection Kit (ThermoFisher) ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant proteins were produced in Expi293F cells (ThermoFisher) by transfection of DNA using the ExpiFectamine 293 Transfection Kit (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombinant magnetic protein G beads (Invitrogen, MA, USA) were added for 1 hour at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... 1.61 nM EGF Recombinant Human Protein (Invitrogen, PHG0313), 1.1 μM hydrocortisone (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... bovine pituitary extract and human recombinant epidermal growth factor (Gibco, 37000-015)) and primary gingival keratinocyte (Dermal cell basal medium (ATCC ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Recombinant protein was extracted using BugBuster Protein Extraction Reagent (Thermo Scientific, USA) and purified using cOmplete His-Tag Purification Resin (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 pmol (77 nM) of recombinant dynein tail complex or recombinant protein A (ThermoFisher Scientific) were incubated with 100 μL IgG magnetic beads in 1300 μL IgG binding buffer with rotation for 1 h at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... Recombinant proteins were quantified with Pierce™ BCA Protein Assay Kit (Life Technologies) and the purity of the purified proteins was checked by SDS-PAGE and western blot using anti-His antibody (1:1000 ...
-
bioRxiv - Neuroscience 2019Quote: ... Briefly recombinant Protein G Agarose beads (ThermoFisher cat# 15920010) were washed three times with PBS ...
-
bioRxiv - Microbiology 2021Quote: ... 25 µL packed Recombinant Protein A-Sepharose 4B (Invitrogen) was used to capture the immune complexes for 1 hour at RT ...
-
bioRxiv - Neuroscience 2022Quote: The following recombinant proteins were used: CaMKIIα (#PR4586C, Invitrogen), GST-CaMKIIβ (#02-110 ...
-
bioRxiv - Microbiology 2021Quote: ... followed by incubation with recombinant Protein G agarose (Invitrogen) for 2 h at 4 °C ...
-
bioRxiv - Microbiology 2022Quote: Recombinant protein expression and purification FreeStyle 293F (ThermoFisher Scientific) cells were grown to a density of 1×106 cells/mL at 37°C with 8% CO2 with regular 135 rpm agitation ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Recombinant proteins were produced in Expi293F cells (Gibco, #A14527) following the manufacturer’s directions ...
-
bioRxiv - Microbiology 2023Quote: ... recombinant proteins were purified using Ni-NTA agarose (ThermoFisher), and then buffer exchanged into PBS and concentrated using Amicon Ultracel centrifugal filters (EMD Millipore).
-
bioRxiv - Microbiology 2023Quote: ... Recombinant protein A/G conjugated to HRP (Thermo Fisher) diluted 1:500 in TBST was added each well and the plates were incubated for 1 hour at 37°C then washed four times with TBST ...
-
bioRxiv - Immunology 2023Quote: ... recombinant SARS-CoV-2 S protein (RP-87680, Invitrogen) or recombinant SARS-CoV-2 spike RBD protein (40592-V08H ...
-
bioRxiv - Bioengineering 2023Quote: ... and recombinant human interleukin-2 (IL-2) protein (Invitrogen) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... 50 μl of Recombinant Protein G – Sepharose beads (Invitrogen) per condition were washed 3 times in IP buffer ...
-
bioRxiv - Immunology 2024Quote: Recombinant proteins were expressed in Expi293F cells (Life technologies). Full-length spike proteins were cloned into the pCAGGS mammalian expression vector as previously described79,80 ...
-
bioRxiv - Immunology 2023Quote: ... and an ICAM1 exon 2 (Ig domain 1)-targeting TrueGuide sgRNA (Invitrogen; sequence: CCACAGTTCTCAAAGCACAG) according to the manufacturer’s U2OS protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.36 pM Recombinant Human Bone Morphogenetic Protein 4 (BMP4, Gibco), and 0.08 pM Activin A (Fisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: All recombinant proteins were produced using Expi293F cells (Life Technologies). Spike proteins for enzyme-linked immunosorbent assay (ELISA ...
-
bioRxiv - Neuroscience 2020Quote: Glial-Derived Neurotrophic Factor (GDNF) Recombinant Human Protein (ThermoFisher, #PHC7044)
-
bioRxiv - Neuroscience 2020Quote: Brain-Derived Neurotrophic Factor (BDNF) Recombinant Human Protein (ThermoFisher, #PHC7074)
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant protein was expressed using Expi293F™ Cells (ThermoFisher Scientific) following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... recombinant proteins or commercially available RNase T1 (Thermo Fisher Scientific) were mixed with 0.5 pmol substrate RNAs in 10 µl RNase reaction buffer with EDTA (20 mM Tris-HCl pH7.5 ...
-
bioRxiv - Cell Biology 2022Quote: ... Concentrations of recombinant proteins were measured by NanoDrop OneC (ThermoFisher).
-
bioRxiv - Microbiology 2020Quote: ... Recombinant proteins were prepared by Expi293 Expression System (Thermo Fisher) according to the manufacturer’s instruction ...
-
bioRxiv - Bioengineering 2022Quote: ... and pre-coated vitronectin recombinant human protein (ThermoFisher Scientific #A14700) at 0.5 μg/cm2.
-
bioRxiv - Genetics 2020Quote: ... 40 μL of recombinant protein G agarose beads (Thermo Fisher) were washed three times with 1 mL of ChIP dilution buffer by resuspending beads in the buffer ...