Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for Recombinant Atlantic Salmon il8 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... recombinant spike protein and ACE2 was conjugated with EZ-Link™ Sulfo-NHS-Biotin (1:3 molar ratio; Thermo Fisher) in Dulbecco’s PBS at room temperature for 30 min ...
-
bioRxiv - Microbiology 2020Quote: A baculovirus expression system was used for the expression of DUB2 recombinant protein in sf9 insect cells as described in the Bac-to-Bac Baculovirus Expression protocol (Invitrogen). The gene was first cloned into the PFastBacNKI-his-3C-LIC vector using Ligation Independent Cloning (LIC) ...
-
bioRxiv - Microbiology 2019Quote: ... bacteria resuspended to OD660 0.3 were incubated with 1 µg of recombinant protein in the presence of 1x protease inhibitors (Pierce, Thermo Scientific) in sterile 1.5 ml microcentrifuge tubes with gentle end-over-end mixing for 30 min at 25°C.
-
bioRxiv - Immunology 2021Quote: For competitive ELISA recombinant hACE2 protein were immobilized (400 ng per well) on immunoplates (Nunc MaxiSorp, Thermo Fisher Scientific, USA). RBD-specific nanobodies were mixed with HRP-conjugated recombinant RBD protein (0.2 μg/ml ...
-
bioRxiv - Immunology 2021Quote: ... LPS-primed THP-1 cell lysates or purified recombinant NLRP3 protein were pre-cleaned using streptavidin magnetic beads (88816, ThermoFisher) to remove nonspecific binding ...
-
bioRxiv - Immunology 2021Quote: ... The proteins were then purified by immobilized metal affinity chromatography by using HisPur Ni-NTA (Purify His-tagged recombinant fusion proteins using high-capacity nickel-nitrolotriacetic acid methal-chelate beads) spin columns (ThermoFisher). Recombinant proteins were refolded on the column by gradually removing urea until reaching to a concentration 0 M and then dialyzed against PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... They were adapted and then cultured in feeder-free conditions on culture dishes coated with the Vitronectin Recombinant Human Protein (ThermoFisher) in mTeSR1™ medium (StemCell Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant Breg and GFP protein was labeled with membrane non-permeable biotin according to the manufacturer’s instructions (Thermo Fisher Scientific).
-
bioRxiv - Genomics 2022Quote: ... Recombinant protein was expressed in 8L culture of Spodoptera frugiperda SF9 cells using the Bac-to-Bac system (Thermo Fisher). Cells were cultured at 27°C ...
-
bioRxiv - Plant Biology 2022Quote: ... NiHa-OSR and NoFa-ICL: Fractions containing recombinant protein were pooled and dialyzed using a Slide-A-Lyzer (ThermoFisher Scientific) cassette (20 kDa MWCO ...
-
bioRxiv - Cancer Biology 2022Quote: Recombinant human SHBG (ProSpec, Israel) was directly labeled with Alexa Fluor-555 using a protein conjugation kit (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant GFP and RPH1 proteins were enriched and purified by affinity chromatography using Ni-NTA Superflow resin (Thermo Scientific). Protein concentrations were calculated based on a standard curve created using bovine serum albumin (BSA ...
-
bioRxiv - Genetics 2023Quote: ... All iPSC lines were maintained on Nunc 6-well culture plates (ThermoScientific #140675) coated with recombinant human vitronectin protein at a final concentration of 0.50 ug/cm2 (Gibco #A14700) in complete Essential 8 Medium (complete E8 ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant GST-tagged proteins purification were performed according to the manufacturer’s instructions of PierceTM Glutathione Superflow Agarose (Thermo Fisher Scientific), and recombinant MBP-tagged proteins purification were performed according to the manufacturer’s instructions of Amylose Resin (NEB).
-
bioRxiv - Bioengineering 2023Quote: ... They were cultured on 100-mm Petri dishes coated with human VTN-N truncated recombinant protein (Gibco, Thermo Fisher Scientific). The hiPSCs obtained from Thermo Fisher Scientific were maintained in Essential 8 Medium (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: ... They were cultured on 100-mm Petri dishes coated with human VTN-N truncated recombinant protein (Gibco, Thermo Fisher Scientific). The hiPSCs obtained from Thermo Fisher Scientific were maintained in Essential 8 Medium (Gibco ...
-
bioRxiv - Molecular Biology 2023Quote: Recombinant Rpb4/Rpb7-6His protein (5 μg) was incubated in a 50 μL slurry of HisPur Cobalt Resin (Thermo Scientific) in binding buffer (20 mM Tris [pH 7.5] and 50 mM NaCl ...
-
bioRxiv - Biochemistry 2023Quote: Plasmids for recombinant protein expression were constructed using mega primer insertion PCR [64] using the plasmid Champion pET303/CT-His vector (Invitrogen). The double-stranded DNA inserts (Integrated DNA Technologies ...
-
bioRxiv - Bioengineering 2020Quote: ... sender cells were initially resuspended and incubated with 100 µg/mL salmon sperm DNA (Thermo Fisher Scientific 15632011). Sender cells were then incubated with 3.5 µM HaloTag-conjugated oligonucleotides (5AmMC12/TCTAGGCGCCCGGAATTAGAT/3Bio ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 250 μ nuclear stain (1:600) and 0.5 mg/ml sheared salmon sperm DNA (Thermo Fisher, #AM9680). DRAQ5 nuclear stain (Cell Signaling Technologies ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 g/L Bovine Serum Albumin (BSA, Fischer Scientific) and 200 mg/L Salmon Sperm DNA solution (Invitrogen).
-
bioRxiv - Plant Biology 2019Quote: ... Beads were pre-treated with 0.1% (w/v) non-fat milk in 1X PBS and 0.5 mg/mL sheared salmon sperm DNA (Invitrogen). Following de-crosslinking ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 µg of DNA and 50 µg of high-quality sheared salmon sperm DNA (Invitrogen-Thermo Fisher Scientific) as carrier DNA were added to a 50 µl aliquot of competent cells ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 µg of DNA and 50 µg of high-quality sheared salmon sperm DNA (Invitrogen-Thermo Fisher Scientific) as carrier DNA were added to a 50 µl aliquot of competent cells ...
-
bioRxiv - Cell Biology 2022Quote: ... blocked in PBB buffer supplemented with 10 µg mL−1 BSA and sheared salmon sperm DNA (Thermo Scientific) and finally taken up in PBB buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... The extracts were then diluted in 5% Tween 20 with UltraPure™ Salmon Sperm DNA Solution (ThermoFisher, 15632011). The amount of AAV that passed through the transwell was measured by qPCR using a standard curve of known AAV quantities derived from AAV-containing media applied to the top well.
-
bioRxiv - Molecular Biology 2021Quote: ... designed using CRISPOR) and 7.5 μg recombinant Cas9 protein (Vienna Biocenter Core Facilities) using the Neon Transfection System (Thermo Fisher Scientific). A week later ...
-
bioRxiv - Cancer Biology 2020Quote: ... The phage library was incubated with biotinylated CD40-Fc fusion protein or Her2 recombinant protein (Acro biosystems) for 2 hours at RT and the phage-antigen complex was captured by Dynabeads M280 (Life technologies). The bound phages were eluted by Glycin-HCl (pH 2.2 ...
-
bioRxiv - Microbiology 2020Quote: One 96-well plate was coated with 200ng/well of recombinant N protein and another plate was coated with 200ng/well of recombinant 6xHis-tagged SARS-CoV-2 spike protein receptor binding domain (RBD) produced using the FreeStyle 293 Expression System (Thermo Fisher) from BEI Resources (Cat# NR-52366 ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant was added to 15 mL of glutathione agarose resin (which binds up to 40 mg of purified recombinant GST protein per milliliter of resin) (Thermo Scientific) and incubated on ice (4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... Canada and maintained in keratinocyte serum-free media supplemented with 0.05 mg/ml of bovine pituitary extract and 0.02 μg/ml EGF recombinant human protein (Life Technologies, Benicia, CA) in a 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... The His-tagged recombinant fusion protein was separated by cobalt immobilized metal chelate affinity beads using the HisPur Cobalt Purification Kit (Thermo Scientific) following the procedure described by the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... recombinant SARS-CoV-2 spike protein was conjugated with EZ-Link™ Sulfo-NHS-Biotin (1:3 molar ratio; Thermo Fisher) in Dulbecco’s PBS at room temperature for 30 min ...
-
bioRxiv - Pathology 2021Quote: ... His-tag recombinant SARS-CoV-2 Spike Protein S1/S2 (S-ECD) (1 ng/ml; ThermoFisher Scientific; aa11-1208; RP-87680) or Flag-tag recombinant SARS-CoV-2 Spike RBD (1 ng/ml ...
-
bioRxiv - Immunology 2021Quote: Monoclonal antibodies or recombinant SARS-CoV-2 RBD + SBD1 or NTD proteins were transfected in FreeStyle 293F suspension cells (Life Technologies) using PEIMAX transfection reagent (Polysciences) ...
-
bioRxiv - Immunology 2021Quote: Thermal melt analysis of the recombinant proteins was performed in triplicate in 96-well plates in a QuantStudio 7 Flex real time PCR machine (Applied Biosystems). Each well contained 2-4 μg protein in buffer (25mM TRIS pH 8 ...
-
bioRxiv - Molecular Biology 2020Quote: ... # 236-EG), 20 ng/ml recombinant human FGF basic protein (R&D, # 4114-TC),1% penicillin/streptomycin (P/S, Invitrogen, SV30010), 1% sodium pyruvate (Gibco ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were seeded in 96-well-plates and treated with 10μg/ml OM-85 concentrate (OM-Pharma) or 100 ng/mL of human recombinant IFN-β protein (ThermoFisher Scientific). The concentration of 10μg/ml of OM-85 was based on previous data with RSV we recently generated [9] ...
-
bioRxiv - Molecular Biology 2022Quote: ... Then 3 μg of purified recombinant protein was added with 4 μl of RiboLock RNase Inhibitor (Thermo Fisher Scientific, Waltham, MA). The mixture was incubated at room temperature for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 Spike RBD 319-541 recombinant protein (OBA0101, Ovodan Biotech) was expressed in 25 mL culture using the Expi293F expression system (#A14635; ThermoFisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... The cells were treated with the appropriate concentration of recombinant proteins and YO-PRO (Thermo Fisher Scientific, diluted at 1:2000) and incubated at 37°C ...
-
bioRxiv - Genetics 2023Quote: ... The presence of recombinant CENH3 proteins on the membrane was always verified by detection with the HisG epitope tag antibody (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... PIK3CA/PIK3R1 (p110a/p85a) recombinant human protein for use in the experiment shown in Figure 4F was purchased from Thermo Fisher Scientific (catalog number PV4788).
-
bioRxiv - Immunology 2023Quote: ... designed using CRISPOR) and 7.5 μg recombinant Cas9 protein (Vienna Biocenter Core Facilities) using the Neon Transfection System (Thermo Fisher Scientific). A week later ...
-
bioRxiv - Biochemistry 2023Quote: Recombinant trimeric spike proteins (5 µg/mL) were plated in 50 µl in each well on a MaxiSorp (Thermo Fisher Scientific) microtiter plate in 1xPBS and left to incubate for at least 1 h at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: About 3 ml of bleed 3 was diluted in 7 ml of sterile 1X PBS and passed through 0.2 μM filter and incubated with recombinant protein G sepharose 4B beads (Life Technologies 101242) at 4℃ overnight ...
-
bioRxiv - Developmental Biology 2024Quote: ... 293 cells were transfected with plasmids encoding His-tagged recombinant proteins as described in the Plasmids section using lipofectamine 2000 (Invitrogen, #11668019) following the manufacturer’s instructions (four 100 mm plates each plasmid) ...
-
bioRxiv - Microbiology 2024Quote: ... Purity of the recombinant PfPKG proteins was assessed by SDS-PAGE using NuPAGETM Novex® 3-8 % Tris-Acetate gels (Invitrogen) and expression was confirmed by Western blot analysis.
-
bioRxiv - Bioengineering 2024Quote: ... The cell clumps in Matrigel dome were cultured in the EM supplemented with 25 ng/mL human active BMP7 recombinant protein (Gibco; PHC7204) initially for 3 - 6 days to regenerate and form Exp-HLOs using BMP7 ...
-
bioRxiv - Immunology 2022Quote: ... 100 ng/mL Human Recombinant IL-4 and 250 ng/mL Human Recombinant GM-CSF (ThermoFisher) for six days at 37°C and 5% CO2 ...