Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for Real Time Thermal Cycler Thermocycler Accessories since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: Protein thermal melting shift experiments were performed using the StepOnePlus™ Real-Time PCR System (Applied Biosystems). Proteins were buffered in 20 mM HEPES pH 7.5 ...
-
bioRxiv - Biochemistry 2023Quote: Thermal shift assays were performed with a StepOnePlus real-time polymerase chain reaction (PCR) machine (Life Technologies) using SYPRO Orange dye (Invitrogen ...
-
bioRxiv - Biochemistry 2024Quote: Thermal stability was verified using the StepOne Real-Time PCR system (Thermo Fisher Scientific Japan, Tokyo, Japan) and accompanying system control software ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and reactions were run on a Veriti Thermal Cycler (Applied Biosystems). PCR products were checked on 2% agarose gels ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA was PCR-amplified on a 2720 Thermal Cycler (Applied Biosystems) in 96-well plates with each well containing 1μl of dried DNA ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCR amplification reaction performed on Veriti thermal cycler (Applied Biosystems, USA) with total volume of 10 μl comprising of 20-30 ng template DNA ...
-
bioRxiv - Physiology 2020Quote: ... PCR was run in a SimpliAmp™ Thermal Cycler (Thermo Scientific) with the following profile ...
-
bioRxiv - Cancer Biology 2020Quote: ... RT-qPCR analysis was performed on StepOnePlus thermal cycler (Thermo scientific) with SYBR Select Master Mix (Thermo scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... with the reaction taking place on the StepOnePlus thermal cycler (ThermoFisher), and the average telomere length was calculated using the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... The reactions were performed in a SimpliAmp Thermal Cycler (Applied Biosystems) using the following conditions ...
-
bioRxiv - Neuroscience 2022Quote: ... Reactions were run on a SimpliAmp™ Thermal Cycler (Applied Biosystems). Primers used were ...
-
bioRxiv - Microbiology 2022Quote: ... PCR was conducted on an ABI 2720 thermal cycler (Thermo Fisher), using GoTaq Green Master Mix (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... Amplification was carried out in a PCR Thermal Cycler (Thermo Scientific) with a preliminary denaturation step at 94 °C for 5 min ...
-
bioRxiv - Biochemistry 2022Quote: ... in an ABI 7300 thermal cycler (Applied Biosystems, Foster City, CA). All data were normalized to Actb or Tbp ...
-
bioRxiv - Biophysics 2021Quote: ... and then amplified in a Veriti thermal cycler (Applied Biosystems, USA) using the following amplification cycling conditions ...
-
bioRxiv - Bioengineering 2020Quote: ... Experiments were performed using a QuantStudio7 Flex thermal cycler (Applied Biosystems).
-
bioRxiv - Genetics 2022Quote: Amplification was completed using a Veriti Thermal Cycler (Applied Biosystems International) using the parameters described by Zephyr and Walsh (2015) ...
-
bioRxiv - Pathology 2020Quote: ... PCR amplification was performed with a programmable thermal cycler (Applied Biosystems). The amplification protocol was carried out as follows ...
-
bioRxiv - Developmental Biology 2021Quote: ... per manufacturer instructions using a MiniAmpTM Plus Thermal Cycler (ThermoFisher Scientific). No template control and no RT controls were prepared ...
-
bioRxiv - Microbiology 2021Quote: ... Amplifications were run on a QuantStudio 5 thermal cycler (Thermo Fisher) and results were analyzed using the instrument software ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR reactions were performed on 2720 Thermal cycler (Applied Biosystems). Primer sequences used for this first amplification were ...
-
bioRxiv - Cell Biology 2020Quote: ... following manufacturers protocol using a Thermal Cycler (Applied Biosystems™, USA). The resulting cDNA was used for Quantitative real-time RTPCR (qRTPCR ...
-
bioRxiv - Bioengineering 2020Quote: ... Experiments were performed using a QuantStudio7 Flex thermal cycler (Applied Biosystems). All primer/probe assays for endogenous gene experiments were purchased from Thermo Fisher Scientific (Supplementary Table 5).
-
bioRxiv - Microbiology 2022Quote: ... Samples were amplified in a 2720 thermal cycler (Applied Biosystems, USA). The PCR parameters were 94°C for 30 seconds ...
-
bioRxiv - Biochemistry 2022Quote: ... Reactions were incubated in a thermal cycler (Model 2720, Applied Biosystems) using the following protocol ...
-
bioRxiv - Genetics 2022Quote: ARMS-PCR reaction was performed using SimpliAmp thermal cycler (Applied Biosystems). Two separate reactions were made each labelled as Normal (N ...
-
bioRxiv - Cell Biology 2023Quote: ... The samples were amplified using a Veriti thermal cycler (Thermo Fisher) as follows ...
-
bioRxiv - Microbiology 2023Quote: ... Amplification was accomplished in a QuantStudio 3 thermal cycler (Applied Biosystems) using the following program ...
-
bioRxiv - Microbiology 2023Quote: ... Amplification was performed with the SimpliAmp Thermal Cycler (Applied Biosystems®) using the following settings ...
-
bioRxiv - Genetics 2022Quote: ... the plate was loaded on a SimpliAmp Thermal Cycler (ThermoFisher Scientific) for PCR amplification using the following conditions ...
-
bioRxiv - Physiology 2023Quote: ... and was analyzed using MiniAmp Plus Thermal Cycler (A37835; Applied Biosystems). Gene targets and primer sequences used are listed in Table 2.
-
bioRxiv - Evolutionary Biology 2024Quote: ... PCR reactions were performed in a Veriti™ Thermal Cycler (ThermoFisher) using the Advantage® 2 PCR Kit (Takara Bio ...
-
bioRxiv - Developmental Biology 2023Quote: ... Real-time PCR was performed using an ABI 7500 thermocycler with Power SYBR Green PCR Kit (Thermo Fisher, 4368702). The relative expression of interested genes is normalized to the expression of 18S rRNA or β-actin ...
-
bioRxiv - Developmental Biology 2023Quote: ... Real-time quantitative PCR (qPCR) was performed using a StepOne thermocycler with a Sybr green mix kit (Applied Biosystems). Primer sequences were chosen for Eln (forward ...
-
bioRxiv - Immunology 2021Quote: ... TaqMan real-time quantitative RT-PCR was performed utilizing the Applied Biosystems StepOne Plus cycler (Applied Biosystems) and TaqMan Gene Expression Assay primer and probe sets (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... and then quantified by real-time quantitative PCR (RT–qPCR) on a Viia7 light cycler (Applied Biosystems) using iTaq Universal SYBR Green Supermix (BioRad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... according to manufacturer’s instructions and analysed on a QuantStudio Real-Time PCR Light Cycler (Thermo Fisher Scientific). Transposon and ZsGreen reporter transcript levels were calculated using the ΔΔCT method (Livak & Schmittgen ...
-
bioRxiv - Plant Biology 2020Quote: ... The qRT-PCR was performed using a StepOne Plus Real-Time PCR Thermo-cycler (Fisher Scientific, Canada), with an initial GoTaq® Hot Start Polymerase activation step at 95 °C for 2 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative real-time PCR was performed in 96 well plates with a QuantStudio3 Cycler (Applied Biosystems, USA), using TaqMan Gene Expression Assays (ThermoFisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR was carried out with a Step-One PLUS Fast Real-time PCR cycler (Applied Biosystems) under standard fast cycling conditions using PowerUP SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... Amplification was performed on the qPCR cycler (QuantStudio™ 6 Flex Real-Time PCR System, Applied Biosystems® by Thermo Fischer Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Each sample was done in triplicates in a real-time cycler (Thermo QuantStudio 7 Flex, Thermo Fisher). The following cycle was ...
-
bioRxiv - Immunology 2023Quote: ... and probe (FAM/ACGAGGAGGCTGCAGATTGGGACTTGCA/NFQ/MGB-3’) in a QuantStudio 12K Flex real-time cycler (Applied Biosystems). PCR amplicons of the SIVgag target were used to generate a standard curve and line equation for qPCR analysis ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Viral RNA was amplified on a Thermal Fisher QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific) using FastStart Universal SYBR Green Master mix (carboxy-X-rhodamine ...
-
bioRxiv - Bioengineering 2023Quote: ... TaqManTM Duplex PCR was run on BioRad’s C1000 Thermal cycle CFX96 Real Time System using 20µL reaction mixture including 10µL TaqManTM Fast Advanced Master Mix (ThermoFisher), 4µL DNA ...
-
bioRxiv - Genetics 2022Quote: ... 250 nM primers up to a final volume of 10 μL were cycled using a ViiA7 real-time thermocycler and QuantStudio V1.3 (Applied Biosystems). Cycling conditions were as follows ...
-
bioRxiv - Neuroscience 2020Quote: ... Ten nanograms of cDNA were amplified in the Applied Biosystems 7500 Fast Real Time PCR System thermocycler (Thermo Fisher Scientific) with the polymerase ready mix (KAPA SYBR FAST ...
-
bioRxiv - Developmental Biology 2021Quote: ... Gene expression analysis was then performed by Real Time quantitative PCR (qPCR) using a QuantStudio 6 Flex thermocycler (Thermo Fisher). We used the following Taqman primers from Thermo Fisher (Supplementary Table 3) ...
-
bioRxiv - Neuroscience 2024Quote: ... Real-time qRT-PCR was performed on the QuantStudio 6 Flex thermocycler using PowerUp SYBR green master mix (ThermoFisher Scientific). All reactions were prepared according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Real-time PCR was performed using quantitative real-time PCR (PikoReal real-time PCR, Thermo Fisher Scientific). PCR (three replicates ...