Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for Rat Presenilin Enhancer 2 Homolog C. Elegans PSENEN ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... IgE ELISA Kit (Thermo Fisher Scientific/Invitrogen, 88-50460-86). IgG ELISA Kit (Thermo Fisher Scientific/Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... IgE ELISA Kit (Thermo Fisher Scientific/Invitrogen, 88-50460-86). IgG ELISA Kit (Thermo Fisher Scientific/Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... and 25 applying Albumin Human ELISA Kit (Cat.No. EHALB, ThermoFisher) on 24 h conditioned medium according to the manufacturer’s instruction ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Activity was determined using MAPKp38 (Total) InstantOne ELISA kit (Invitrogen) and absorbance was read on a microplate reader.
-
bioRxiv - Cell Biology 2023Quote: Aβ40 and Aβ42 levels were mainly measured by Invitrogen amyloid-β human ELISA Kit (Thermo Fisher, KHB3481 and KHB3441) as per the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were analyzed using Human RANTES ELISA Kit (ThermoFisher, EHRNTS) and IL-1RA Human ELISA Kit (ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: ... Cytokine ELISAs were performed using commercially available kits (Life Technologies), screening supernatant from antigen-restimulated splenocytes.
-
bioRxiv - Neuroscience 2023Quote: The IL-6 Receptor (Soluble) Human ELISA Kit (Invitrogen; BMS214) was used to quantify soluble IL-6Ra expression in cell culture media ...
-
bioRxiv - Cell Biology 2024Quote: ... and the mouse insulin solid-phase sandwich ELISA kit (Invitrogen) according to instructions provided by the manufacturer.
-
bioRxiv - Genetics 2024Quote: Mouse IL-6 Uncoated ELISA kit (cat# 88-7064; Invitrogen) was used to measure Interleukin-6 concentrations of mouse tissue lysates ...
-
bioRxiv - Immunology 2024Quote: IFNγ in supernatants from the whole blood RSA was determined by ELISA according to the manufacturer’s instructions (Human IFNγ Uncoated ELISA kit; Invitrogen). 50μl of supernatant was diluted with 50μl of assay diluent for use in the IFNγ ELISA ...
-
bioRxiv - Immunology 2021Quote: ... and incubated overnight at 4°C with rat anti-mouse CD8 (4SM15, Invitrogen) and rabbit anti-mouse Ly6G (E6Z1T ...
-
bioRxiv - Molecular Biology 2022Quote: ... elegans (GTCAAGCTTCGGTCTTCATCCCCAAGCCATTCAGGGCCTTTGCCTTTGTTACATTTGCAGATGATCAGATTGCGCAGTCTCTTTGTGGAGAGGACTTGATCATTAAAGGAATCAGCGTTCATATATCCAATGCCGAACCTAAGCACAATAGCAATAGATCAGTTGGCCCTGATTATGGCCTTCCAGCTGGCTACCGTAACCGCAGAGAACGTGATCGACCGGATAGACGACCGATTCAAAATGAAGCACCTCTGCCCATGCCATTCGTCCGCCCACCACAAGATTACTCATACCGTCAGCAAAATTCTCCCCTCGAGAGGAGATACTGGGCACCTGGAGACTCGAGAGGACCAGGATGGCGGGATCCGTC) was ordered in GeneArt gene synthesis services (Thermo Fisher, Waltham, MA, USA). The fragment was digested and inserted into the HindIII and BamHI sites of pmeGFP-C1 (pGFP-F220c).
-
bioRxiv - Genomics 2020Quote: ... E-cadherin (rat, Life Technologies 131900 clone ECCD-2, 1:100), Mucin 1 (Muc1 ...
-
Kinetochore- and chromosome-driven transition of microtubules into bundles promotes spindle assemblybioRxiv - Cell Biology 2022Quote: ... rat anti-alpha-tubulin YL1/2 (MA1-80017, Invitrogen, CA, SAD), diluted 1:500 ...
-
bioRxiv - Developmental Biology 2019Quote: ... rat anti–E-cadherin (1:1,000; ECCD-2; Thermo Fisher Scientific), rabbit anti-DCLK1 (1:500 ...
-
bioRxiv - Microbiology 2023Quote: ... and Rat-2 cells were cultured in 1x DMEM (ThermoFisher Scientific) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2023Quote: ... Total IgE concentrations were determined in previously frozen samples using a commercially available IgE ELISA kit (IgE Mouse uncoated ELISA Kit, Invitrogen-Thermo Fischer Scientific, Waltham, MA) following the manufacturer’ s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: Mitomycin C (MMC) (Fisher Scientific, BP2531-2).
-
bioRxiv - Evolutionary Biology 2022Quote: ... Stained tissues were treated with Image-iT FX Signal Enhancer (Invitrogen) and washed in 5% normal goat serum in PBS + 0.1% Tween-20 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos were treated with Image-iT Signal Enhancer (ThermoFisher Scientific, I36933) for 30 min ...
-
bioRxiv - Microbiology 2019Quote: ... 2.5 μL of GC enhancer (Thermo Fisher Scientific, Carlsbad, California, USA), 2 μL of DNA (1:10 diluted ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were then incubated with Image-iT FX signal enhancer (ThermoFisher) for 30 min at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... samples were blocked with Image-iT™FX signal enhancer (Invitrogen) for at least 30’ ...
-
bioRxiv - Immunology 2023Quote: ... diluted at 1:600 in Pierce™ Immunostain Enhancer solution (Thermofisher) complemented with 0,5% triton X-100 and 0,1% Tween for 5 days at RT under gentle rocking ...
-
bioRxiv - Cancer Biology 2023Quote: ... and incubated in Image-iT™ FX Signal Enhancer (Thermo Fisher) for 15 minutes at room temperature ...
-
bioRxiv - Biophysics 2023Quote: ... cells were blocked in Image-iT FX signal enhancer (I36933, Invitrogen) for 30 min ...
-
bioRxiv - Bioengineering 2023Quote: ... MCF7 cells required additional treatment with BacMam enhancer (Fisher Scientific, USA) to express FUCCI following manufacturer instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... were also incubated with SuperSignal™ Western Blot Enhancer (Thermo Fisher).
-
bioRxiv - Microbiology 2020Quote: ... Enzyme-linked immunosorbent assays (ELISAs) for human IL-8 were performed using the Human IL-8 ELISA Kit (ThermoFisher SCIENTIFIC) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... Cytokine measurement on tissue homogenate was assessed using ELISA kits according to the manufacturer instructions (Mouse IFN gamma Uncoated ELISA, Invitrogen, #88-7314 ...
-
bioRxiv - Immunology 2019Quote: ... Cytokine measurement on tissue homogenate was assessed using ELISA kits according to the manufacturer instructions (Mouse IFN gamma Uncoated ELISA, Invitrogen, #88-7314; Mouse TNF alpha Uncoated ELISA, Invitrogen, #88-7324 ...
-
bioRxiv - Immunology 2021Quote: IL-17a ELISAs were performed using Human IL-17A (homodimer) ELISA Ready-SET-Go!™ Kit (Invitrogen™; eBioscience™), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... and RNA was reverse transcribed using Verso cDNA kit with random hexamers and RT enhancer (Thermo Fisher, Waltham, MA, USA). PCR amplification of conserved coronavirus regions using previously reported primer pairs was used to screen the cDNA [60] ...
-
bioRxiv - Genetics 2021Quote: ... by using PCR stitching to create an enhancer reporter which was sequence verified and purified with a PureLink PCR purification kit (ThermoFisher) for injection ...
-
bioRxiv - Microbiology 2020Quote: ... consisting of lysis enhancer and resuspension buffer at a 1:10 ratio (both from the CellsDirect One-Step RT-qPCR kit; Invitrogen). Next ...
-
bioRxiv - Genetics 2020Quote: ... The section of the membrane with separated 300 - 95 kDa proteins was incubated with primary antibodies against C-terminus of Pol2 described in the previous section at 1:500 – 1:1,000 dilution in diluent provided in SuperSignal Western Blot Enhancer Kit (Thermo Fisher). Section of the membrane with 75-50 kDa proteins was incubated with rat monoclonal antibodies against yeast α-tubulin (sc-53030 ...
-
bioRxiv - Immunology 2019Quote: ... eBioscience Mouse IL-6 ELISA Ready-SET-Go! Kit (Fisher Scientific #50-112-8863; IL-1 beta Mouse Uncoated ELISA Kit (Thermo Fisher Scientific #88-7013-88).
-
bioRxiv - Biochemistry 2021Quote: ... elegans DRH-3 (UniProt Q93413) was inserted into the bacterial expression vector Champion pET-SUMO (Invitrogen). The resulting plasmid encodes full-length DRH-3 (DRH-3FL ...
-
bioRxiv - Bioengineering 2019Quote: ... elegans samples was done by adding 150 μl lysis buffer (RIPA buffer (ThermoFisher #89900, Reinach, Switzerland), 20 mM sodium fluoride (Sigma #67414 ...
-
bioRxiv - Genetics 2021Quote: ... We quantified expression using the IgG4 Human ELISA kit (Invitrogen BMS2095) with IgG4 standards provided in the kit ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... IL-1β and TNFα were analyzed using ELISA kits (Thermo Scientific) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... and IL-10 Mouse Uncoated ELISA Kit (88-7105-86, Invitrogen), respectively ...
-
bioRxiv - Immunology 2022Quote: Murine TNF-α and IL-1β were quantified in cell supernatants using ELISA™ Kit from Invitrogen and human IL-1β using Instant ELISA™ Kit from Invitrogen, following manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: The IL-33 Quantikine ELISA kit was purchased from Applied Biosystems and manufacturer instructions were followed ...
-
bioRxiv - Immunology 2020Quote: IL-13 was measured using an eBioscience ELISA kit (Thermo Scientific) using the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Corticosterone levels were determined using the Corticosterone Competitive ELISA kit (Invitrogen) and normalized to the weights of colon pieces measured before the assay.
-
bioRxiv - Neuroscience 2021Quote: ... IL-6 and IL-1β using mouse ELISA kits (Thermo Scientific).
-
bioRxiv - Molecular Biology 2020Quote: ... and blood serum insulin levels (Mouse Insulin Elisa kit, Thermo Scientific) according to the manufacturers’ instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and IFN-β were detected using an ELISA kit (Thermo Scientific) as previously described (26) ...