Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for Rat Myristoylated Alanine Rich C Kinase Substrate MARCKS ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... and 200μl of tetramethylbenzidine (TMB) ELISA substrate (Thermo Fisher Scientific; cat. no. 34028) was added to each well ...
-
bioRxiv - Microbiology 2021Quote: ... ELISA plates were developed using 100μl of TMB substrate (Thermo Fisher Cat# 34029). OD 450 reading was measured via BioTek ELISA microplate reader.
-
bioRxiv - Microbiology 2022Quote: ... The antigen-antibody reaction was probed by TMB ELISA Substrate Solution (Invitrogen eBioscience) and was terminated with 1M sulfuric acid after 15 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Plates were washed and 1-Step Ultra-TMB ELISA Substrate Solution (Thermo Scientific) was added to develop the plates ...
-
bioRxiv - Immunology 2021Quote: ... followed by 100 µL of TMB-ELISA substrate (Thermo Fisher Scientific catalog # 34028) and incubated at room temperature for 3 to 5 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... The substrate solution was 1-StepTM Ultra TMB-ELISA (Thermo Fisher Scientific, 34028) and the stop solution was 2N sulfuric acid (VWR ...
-
bioRxiv - Immunology 2022Quote: ... developed using SuperSignal ELISA Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, Waltham, MA), and read at 425 nm ...
-
bioRxiv - Physiology 2023Quote: ... One hundred microliters of One-step Ultra TMB ELISA substrate (Thermo Scientific #34028) was added to each well ...
-
bioRxiv - Immunology 2023Quote: ... 100 μL of 1-Step Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific) was added to each well ...
-
bioRxiv - Immunology 2023Quote: ... and then 3,3’,5,5’ Tetramethylbenzidine (TMB)-ELISA substrate solution (Thermo Fisher Scientific, 34029) was added and incubated in the dark for 15-20 minutes ...
-
Molecular insights into the atypical activation mechanism of GPR156 in maintaining auditory functionbioRxiv - Molecular Biology 2024Quote: ... Luminescence detection was performed using SuperSignal ELISA Femto Maximum Sensitivity substrate (ThermoFisher Scientific) after binding of antibodies coupled to horse-radish peroxidase ...
-
bioRxiv - Immunology 2023Quote: ... tumor necrosis factor alpha (TNFα) and C-C motif chemokine ligand 2 (CCL2) concentrations were evaluated using the Ready-SET-Go!™ ELISA kits (ThermoFisher Scientific). CCL24 concentrations were evaluated using the Mouse CCL24/Eotaxin-2/MPIF-2 DuoSet ELISA kit (R&D Systems) ...
-
bioRxiv - Immunology 2024Quote: ... and ELISA analysis (human IL-1β ELISA Kit, Thermo Fisher Scientific) according to the manufacturer ‘s instructions.
-
bioRxiv - Immunology 2021Quote: ... IL-2 Human Uncoated ELISA kit and IFNγ Human Uncoated ELISA kit (both from Invitrogen) and DuoSet Human IFN-gamma kit and Ancillary Reagent Kit 2 (R&D Systems ...
-
bioRxiv - Pathology 2022Quote: ... Aβ42 human ultrasensitive ELISA Kit and Tau (phospho) [pT231] human ELISA Kit from Thermo Fisher, and sAPPα and sAPPβ ELISA Kit from Mybiosource ...
-
bioRxiv - Bioengineering 2023Quote: ... the solution from b) and c) were collected and measured using an insulin ELISA kit (Thermo Fisher for mouse islets ...
-
bioRxiv - Bioengineering 2022Quote: ... ECM-coated substrates with rat tail collagen I (Thermo Fisher Scientific, #A1048301) or human plasma fibronectin (#33-016-015) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The washing procedure was repeated and 50 μL of the buffer containing substrate (1-Step Ultra TMB ELISA Substrate, Thermo Scientific) was added to develop the colorimetric reaction for 15 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... The washing procedure was repeated and 50 μL of the buffer containing substrate (1-Step Ultra TMB ELISA Substrate, Thermo Scientific) was added to develop the colorimetric reaction for 15 min ...
-
bioRxiv - Biochemistry 2020Quote: ... the first exon of HRI was amplified by PCR using primers located within the promoter and first intron (Forward: CTAGCTGCAGCATCGGAGT, Reverse: GAGGCAGACGTTCTTTTCAA) using AccuPrime G-C rich polymerase (Invitrogen). Amplicons were cloned into pGEM-T Easy vector (Promega ...
-
bioRxiv - Cancer Biology 2019Quote: ... The ELISA test was performed using IFNa Mouse ELISA Kit (Thermo Fisher) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... We determined sIgA concentrations by ELISA (Human IgA ELISA kit; Thermo Fisher), replacing the provided monomeric IgA standards with sIgA ELISA standards (Abnova) ...
-
bioRxiv - Microbiology 2023Quote: ... Kits used for ELISA were TGF-β1 Mouse ELISA Kit (Thermo Fisher Sci Cat. # BMS608-4TWO), Mouse Testosterone ELISA Kit (Crystal Chem ...
-
bioRxiv - Immunology 2021Quote: ... 50 μl/well of 1-Step™ Ultra TMB-ELISA Substrate Solution (ThermoFisher, 34028) was applied and the enzyme-substrate reaction was stopped after six minutes using 50 μl/well sulphuric acid (1 M H2SO4) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Bound secondary antibody was detected using Ultra TMB One-Step ELISA substrate (Thermo Fisher). After quenching the reaction with sulfuric acid ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 50 μL/well of TMB substrate (1-Step Ultra TMB-ELISA, Thermo Scientific, #34028) was added ...
-
bioRxiv - Bioengineering 2021Quote: ... Plates were developed with 1-step Turbo TMB-ELISA Substrate Solution (Thermo Fisher Scientific) and 2N HCl ...
-
bioRxiv - Immunology 2020Quote: ... and 50 μl of 1-Step™Ultra TMB-ELISA Substrate Solution (ThermoFisher, #34029) was added for 15 min at room temperature and the reaction was quenched with 50 μL stop solution containing 0.16N sulfuric acid (ThermoFisher ...
-
bioRxiv - Immunology 2021Quote: ... and development using 1-Step™ Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific).
-
bioRxiv - Biophysics 2022Quote: ... The plates were developed with TMB-ELISA substrate (Thermo Fisher Scientific, Cat. no. 34028) until the light blue color appeared ...
-
bioRxiv - Immunology 2022Quote: ... Plates were developed with 1-Step™ Ultra TBM-ELISA substrate solution (Thermo Fisher) and stopped with equal volume 1N H2SO4 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 100 μL 1-Step™ Ultra TMB-ELISA Substrate Solution (3,3’,5,5’-tetramethylbenzidine) (ThermoFisher) was added to the plates and incubated for 1 minute to start HRP activity and 100 μL 2M sulfuric acid was added to stop the reaction ...
-
bioRxiv - Microbiology 2023Quote: ... and 50 µL of 1-step Ultra TMB-ELISA substrate solution (Thermo Fisher Scientific) was added to all wells ...
-
bioRxiv - Neuroscience 2023Quote: ... then exposed with 100µL 1-step ultra TMB-ELISA substrate solution (Thermo Scientific; 34028) for 5 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... The bound mAbs were detected with SuperSignal ELISA Pico Chemiluminescent Substrate (Thermo Fisher Scientific) and relative luminescence units (RLUs ...
-
bioRxiv - Immunology 2023Quote: ... and developed with 1-Step™ Ultra TMB-ELISA Substrate Solution (Thermo Scientific™). For primary G8 T cells ...
-
bioRxiv - Neuroscience 2023Quote: ... Plates were developed with 1-Step Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific) for 10-15 minutes ...
-
bioRxiv - Immunology 2023Quote: ... 100 μL of room temperature 1-Step Ultra TMB-ELISA Substrate Solution (ThermoFisher #34028) was added to each well and the plate was incubated at 25 °C for 30 min ...
-
bioRxiv - Immunology 2023Quote: ... ELISA plates were developed with the TMB substrate (1-Step Turbo-TMB, Thermo Fisher) for six minutes and terminated with sulfuric acid (2M) ...
-
bioRxiv - Immunology 2022Quote: ... IgA mouse uncoated ELISA kit (ThermoFisher) was used following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... IL-18 Mouse ELISA kit (ThermoFisher), and ELISA MAX Deluxe Set Mouse TNFα (Biolegend) ...
-
bioRxiv - Immunology 2021Quote: ... single ELISA kits were used (ThermoFisher).
-
bioRxiv - Neuroscience 2023Quote: ... Aβ42 human ultrasensitive ELISA Kit (Thermofisher), and D2R (Mybiosource) ...
-
bioRxiv - Immunology 2023Quote: ... IgA and IgE ELISA kits (ThermoFisher 88-50550-88 ...
-
bioRxiv - Neuroscience 2023Quote: ... Human Aβ42 ELISA kit (Invitrogen-KHB3441)
-
bioRxiv - Cancer Biology 2024Quote: ... substrate (Pierce TMB Substrate Kit, Thermo Fisher Scientific, Massachusetts, US) was administered ...
-
bioRxiv - Pathology 2023Quote: Serum alanine aminotransferase (ALT) levels were measured using A Pointe Scientific ALT Assay kit by Fisher Scientific according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... Human TNF-α Ultrasensitive ELISA Kit (Invitrogen,KHC3014 [96 tests] and Human IFNα ELISA Kit [Invitrogen,BMS216TEN]) were used for cytokine quantification.
-
bioRxiv - Neuroscience 2021Quote: ... SuperSignal™ West Femto Maximum Sensitivity Substrate kit (Thermo Fisher Scientific) was used for HRP-signal detection and finally signals were visualized by ChemiDoc Imaging System (BIORAD) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Cells were maintained in rich growth media (F10 (Gibco), 20% FBS (Gibco) ...