Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for Rat LIM Domain Kinase 2 LIMK2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Human Aβ42 ELISA kit (Invitrogen-KHB3441)
-
bioRxiv - Immunology 2019Quote: ... the human IL-2 ELISA kit was used in accordance with manufacturer’s instructions (Thermo Fisher Scientific). Murine IL-2 ELISA’s were performed using the mouse IL-2 ELISA kit (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2023Quote: ... The supernatant was collected on day 3 and analyzed by human IL-2 ELISA Kit (ThermoFisher) according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2023Quote: ... and an ICAM1 exon 2 (Ig domain 1)-targeting TrueGuide sgRNA (Invitrogen; sequence: CCACAGTTCTCAAAGCACAG) according to the manufacturer’s U2OS protocol ...
-
bioRxiv - Immunology 2021Quote: ... the concentrations of human IL-2 and IFN-γ were measured using a IL-2 Human Uncoated ELISA Kit (Thermo Fisher) and IFN-γ Human Uncoated ELISA Kit (Invitrogen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The concentration of IL-2 in 2x diluted supernatants was measured using an IL-2 mouse ELISA kit (Thermo Fisher Scientific) as per the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... E-cadherin (rat, Life Technologies ECCD-2), Podoplanin (hamster ...
-
bioRxiv - Molecular Biology 2019Quote: ... tubulin (rat, YL1/2, Invitrogen, MA1-80017), Aly (rabbit polyclonal (2) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human TNF-α Ultrasensitive ELISA Kit (Invitrogen,KHC3014 [96 tests] and Human IFNα ELISA Kit [Invitrogen,BMS216TEN]) were used for cytokine quantification.
-
bioRxiv - Immunology 2023Quote: The inhibition of kinase activity mediated by phospholipids was determined using the following Z’-LYTE Kinase Assay Kits: Z’-LYTE Kinase Assay Kit - Ser/Thr 6 Peptide (Thermo Fisher Scientific, Cat# PV3179) used to measure AKT activity and the Z’-LYTE Kinase Assay Kit - Ser/Thr 7 Peptide (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: The concentration of secreted Tgfβ1 ligand levels was measured by taking 3-day conditioned media at d5 of culture with Tgf beta-1/LAP Rat Uncoated ELISA Kit with Plates by following the manufacturer’s protocol (ThermoFisher Scientific, Waltham, MA). The cells were cultured in a 2% FBS media for ELISA ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and the supernatant was taken to measure the amount of secreted IL-10 using the IL-10 Rat ELISA Kit (Invitrogen, catalog # BMS629). The resulting values were normalized based on the cell viability ...
-
bioRxiv - Cancer Biology 2019Quote: ... Amyloid Beta-40 ELISA was performed using the Human AB40 ELISA Kit (Invitrogen). Secretion values were normalized to protein content of wells as measured by RIPA harvest and BCA protein quantification.
-
bioRxiv - Molecular Biology 2020Quote: ... supernatants were diluted 4-fold and assayed with the Amyloid beta 40 Human ELISA Kit and either the Amyloid beta 42 Human ELISA Kit or the Amyloid beta 42 Human ELISA Kit Ultrasensitive (Invitrogen), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... We prepared 100-μL reactions consisting of 2 µM biosensor and 300 nM Src kinase in 1X kinase buffer A (Thermo Fisher Scientific, Inc.) supplemented with 2 mM DTT ...
-
bioRxiv - Neuroscience 2022Quote: ... Total RNA was extracted from the thalamus of 2 GAERS (10 and 90 days) and 2 NEC (10 and 90 days) male rats using a MagMax Kit (Ambion) and full length cDNAs generated using SuperScriptII with oligo-dT priming (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Supernatant was harvested at the indicated timepoints and IL-2 levels in the supernatant were measured via IL-2 Human Instant ELISA kit (Thermo Fisher #BMS221INST). T-cell proliferation was also measured at the indicated timepoints using a BD FACSymphony Fortessa X-50.
-
bioRxiv - Neuroscience 2020Quote: Levels of total APOE protein were analysed by Human ELISA Kit from Invitrogen (Apolipoprotein E Human ELISA Kit). Levels of Aβ were analysed by ELISA (Human β Amyloid 42 ELISA Kit Wako high sensitive #298-64401 and Human β Amyloid 40 ELISA Kit Wako #298-64601 ...
-
bioRxiv - Bioengineering 2021Quote: ... CCL2 was quantified using a rat CCL2 ELISA (Cat. # KRC1012 Life Technologies, Carlsbad, CA, USA) according to manufacturer’s instructions and buffer modifications described in Yarmola et al (29) ...
-
bioRxiv - Neuroscience 2020Quote: ... and Aβ42 ELISA kits were from Invitrogen. Anti-puromycin antibody (12D10 ...
-
bioRxiv - Immunology 2021Quote: ... IL-6 mouse ELISA kit (ThermoFisher Scientific) and IL-1β mouse ELISA kit (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ELISA used the kit from Thermo Fisher Scientific (human GDNF ...
-
bioRxiv - Neuroscience 2020Quote: ... or Aβ1-40 ELISA kit (KMB3441, ThermoFisher).
-
bioRxiv - Neuroscience 2022Quote: ... the human Aβ42 Ultrasensitive ELISA Kit (Invitrogen) was used according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... IL-1β ELISA kit was from Invitrogen (#88-7261 ...
-
bioRxiv - Immunology 2021Quote: ... the Human Osteopontin ELISA kit (Thermo Fisher) was used following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... IL-6 Mouse ELISA kit (ThermoFisher, USA) was used ...
-
bioRxiv - Cell Biology 2022Quote: ... and the HGF Human ELISA Kit (Invitrogen) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human TNF-α Ultrasensitive ELISA Kit (Invitrogen,KHC3014 [96 tests] and Human IFNα ELISA Kit [Invitrogen,BMS216TEN] ...
-
bioRxiv - Neuroscience 2022Quote: ... The following ELISA kits from Thermo Fisher Scientific were used according to the manufacturer’s protocols ...
-
bioRxiv - Immunology 2023Quote: All ELISA kits were purchased from ThermoFisher Scientific Inc ...
-
bioRxiv - Bioengineering 2023Quote: ... All ELISA kits were purchased from ThermoFisher Scientific ...
-
Activation of glucocorticoid receptor signaling inhibits KSHV-induced inflammation and tumorigenesisbioRxiv - Cancer Biology 2023Quote: ... and IL-1Ra ELISA Kit (Invitrogen, ERA22RB) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... ELISA was performed with Human IL-8 ELISA Ready-SET-Go kit (Affymetrix eBioscience) according to manufacturer’s protocol.
-
bioRxiv - Cell Biology 2020Quote: ... extracellular signal-regulated kinase kinase (MEK, Ambion: Cat. no. s11167), Akt1 (Ambion ...
-
bioRxiv - Neuroscience 2023Quote: ... Amyloid Aβ40 and Aβ42 in the hippocampus and striatum and D2R in the striatum were quantified by ELISA with the following kits: Aβ40 human ELISA kit (Thermofisher); Aβ42 human ultrasensitive ELISA Kit (Thermofisher) ...
-
bioRxiv - Immunology 2022Quote: ... blocked for 2 hr at RT with Elisa diluent (Invitrogen) (Ref ...
-
bioRxiv - Molecular Biology 2022Quote: ... ERK activation were assessed 20 min after treatment by using ERK1/2 (phospho-T203/Y204) ELISA Kit (Invitrogen) corrected for the amount of total ERK using ERK1/2 (Total ...
-
bioRxiv - Immunology 2021Quote: ... and anti-Spike IgG was quantified using a Human SARS-CoV-2 Spike (Trimer) IgG ELISA Kit (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: The following enzyme-linked immunoassay (ELISA) kits were used to analyze secreted factors: IL-18 (BMS267-2, Thermofisher) and IL-8 (D8000C ...
-
bioRxiv - Immunology 2021Quote: ... ELISA was performed using IFN gamma Human Uncoated ELISA Kit (Thermo Fisher Scientific, Massachusetts, USA). For assessing cytotoxicity 5 × 103 RPMI 8226 cells expressing luciferase-GFP were co-cultured with the different effector T cells at several effector ...
-
bioRxiv - Neuroscience 2022Quote: ... The ELISA procedure was performed as described by the ELISA kit manufacturer (Invitrogen, Camarillo, CA).
-
bioRxiv - Cell Biology 2022Quote: ... 2 µL 1 M DTT and 27.5 µL of T4 Polynucleotide Kinase (Thermo Scientific) were added to the annealed oligonucleotides and the reaction was incubated for 2 h at 37 °C ...
-
bioRxiv - Immunology 2020Quote: ... IL-1β ELISA kit (Catalog # 88-7013-22) and TNFα ELISA kit (Catalog # 88-7324-88) were from Invitrogen (America). LDH Cytotoxicity Assay Kit (C00170 ...
-
bioRxiv - Immunology 2022Quote: Invitrogen Uncoated ELISA kits for IFNγ (Thermo Fisher) were used following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... and IL-1β Mouse ELISA Kits (ThermoFisher Scientific), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... and IL-1β mouse ELISA kit (ThermoFisher Scientific), following manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... ELISA kits were from eBioscience (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2021Quote: ... and IFN-γ Human Uncoated ELISA Kit (Invitrogen), respectively ...
-
bioRxiv - Immunology 2022Quote: ... ELISA kits were from eBioscience (Thermo Fisher Scientific). Flow cytometry antibodies were from eBioscience ...