Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for Rat Histone Deacetylase 1 HDAC1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Enzyme-linked immunosorbent assays (ELISAs) for human IL-8 were performed using the Human IL-8 ELISA Kit (ThermoFisher SCIENTIFIC) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... Cytokine measurement on tissue homogenate was assessed using ELISA kits according to the manufacturer instructions (Mouse IFN gamma Uncoated ELISA, Invitrogen, #88-7314 ...
-
bioRxiv - Immunology 2019Quote: ... Cytokine measurement on tissue homogenate was assessed using ELISA kits according to the manufacturer instructions (Mouse IFN gamma Uncoated ELISA, Invitrogen, #88-7314; Mouse TNF alpha Uncoated ELISA, Invitrogen, #88-7324 ...
-
bioRxiv - Immunology 2021Quote: IL-17a ELISAs were performed using Human IL-17A (homodimer) ELISA Ready-SET-Go!™ Kit (Invitrogen™; eBioscience™), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Histone mouse monoclonal antibody (Fisher Scientific, Cat# AHO1432 ...
-
bioRxiv - Immunology 2020Quote: ... Acetyl-Histone H4 (PA5-40084, Invitrogen); Linear ubiquitin (LUB9 ...
-
bioRxiv - Genetics 2021Quote: ... We quantified expression using the IgG4 Human ELISA kit (Invitrogen BMS2095) with IgG4 standards provided in the kit ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... IL-1β and TNFα were analyzed using ELISA kits (Thermo Scientific) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... and IL-10 Mouse Uncoated ELISA Kit (88-7105-86, Invitrogen), respectively ...
-
bioRxiv - Immunology 2022Quote: Murine TNF-α and IL-1β were quantified in cell supernatants using ELISA™ Kit from Invitrogen and human IL-1β using Instant ELISA™ Kit from Invitrogen, following manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: The IL-33 Quantikine ELISA kit was purchased from Applied Biosystems and manufacturer instructions were followed ...
-
bioRxiv - Immunology 2020Quote: IL-13 was measured using an eBioscience ELISA kit (Thermo Scientific) using the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Corticosterone levels were determined using the Corticosterone Competitive ELISA kit (Invitrogen) and normalized to the weights of colon pieces measured before the assay.
-
bioRxiv - Neuroscience 2021Quote: ... IL-6 and IL-1β using mouse ELISA kits (Thermo Scientific).
-
bioRxiv - Molecular Biology 2020Quote: ... and blood serum insulin levels (Mouse Insulin Elisa kit, Thermo Scientific) according to the manufacturers’ instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and IFN-β were detected using an ELISA kit (Thermo Scientific) as previously described (26) ...
-
bioRxiv - Bioengineering 2020Quote: ... An IgG4 Human ELISA Kit (Cat # BMS2095, Thermo Fisher, Waltham, MA) was purchased to verify the antibody secretion titer according to the manufacturers instructions.
-
bioRxiv - Immunology 2019Quote: ... eBioscience Mouse IL-6 ELISA Ready-SET-Go! Kit (Fisher Scientific #50-112-8863 ...
-
bioRxiv - Immunology 2021Quote: Elastase was measured using the Human PMN-Elastase ELISA Kit (Invitrogen) in neutrophil culture supernatant at 6 hours after stimulation ...
-
bioRxiv - Immunology 2021Quote: Human TNF alpha Uncoated ELISA Kit (ThermoFisher, catalog no. 88-7346) was used to determine secretion of TNF-α in culture supernatants of cells treated with SARS-CoV-2 S1 subunit ...
-
bioRxiv - Immunology 2020Quote: ... Elisa was performed using a kit from Invitrogen (Carlsbad, CA, USA) (Procartaplex human th1/th2 cytokine panel 11 plex from Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... assays were run using the Complement C5a Human ELISA Kit (Invitrogen). For sample preparation ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The Mouse Th1/Th2 Uncoated ELISA kit was acquired from ThermoFisher Scientific (Catalog Number 88-7711-44).
-
bioRxiv - Cancer Biology 2022Quote: ... Plasma TNFα was quantified using mouse TNFα uncoated ELISA kit (Invitrogen) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... Serum cytokines were measured using commercial mouse cytokine ELISA kits (Invitrogen) according to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2023Quote: ... Samples were analyzed using RANTES Mouse Instant ELISA Kit (Invitrogen, #BMS6009INST) and IL-1RA Mouse ELISA Kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: We used a corticosterone (CORT) competitive ELISA kit (ThermoFisher Ref # EIACORT) to analyze serum corticosterone from trunk blood collected at euthanasia ...
-
bioRxiv - Developmental Biology 2022Quote: ... Rat anti-E-cadherin 1:200 (DCAD2, DSHB) and donkey anti-rat Alexa 488 1:200 (Thermo Fisher Scientific) antibodies were used ...
-
bioRxiv - Immunology 2020Quote: ... Murine IFNγ and IL-2 cytokines were measured in supernatants according to the Murine IFNγ and IL-2 ELISA Ready-SET-GO!® ELISA kit (Invitrogen) according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: HDAC1 was amplified from w1118 cDNA using the primer pair CACCATGCAGTCTCACAGCAAAAAGC/TCAAATGTTGTTCTCCTTGGCG and inserted into pENTR/D-TOPO (Invitrogen). S391A and S391D mutations were introduced by site directed mutagenesis ...
-
bioRxiv - Immunology 2023Quote: ... Histone H2B labelling was done for 36h with CellLight® Histone 2BGFP (Thermo Fisher Scientific, MA, USA) and DNA labeling was done for 24h using BrdU (10 μM Sigma Chemicals ...
-
bioRxiv - Neuroscience 2020Quote: ... The levels of CCL2 (MCP-1) were quantified with mouse CCL2 ELISA kit (Thermo Fisher Scientific, Cat. Nr. BMS6005) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were further diluted 1:100 in standard diluent and Aβ levels were measured with the human Aβ1–42 ELISA kit (Invitrogen) following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... Both fractions were then used to measure the amyloid beta 1-42 (Aβ1-42) using a specific ELISA kit (Invitrogen) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... using rat-anti-BrdU (1:500, OBT0030 Accurate) and donkey-anti-rat Alexa Fluor-568-conjugated secondary antibody (1:1000, Invitrogen).
-
bioRxiv - Cancer Biology 2021Quote: ... A 1-Step Turbo TMB-ELISA substrate solution (Thermo Scientific) was used for detection ...
-
bioRxiv - Immunology 2022Quote: ... 1-Step Ultra TMB-ELISA (Thermo Fisher Sciebtific, Waltham, MA) was added and absorbance was determined at 450nm with a microtiter plate spectrophotometer (BioTech).
-
bioRxiv - Biochemistry 2022Quote: ... 1-Step™ Ultra TMB-ELISA Substrate Solution (ThermoFisher Scientific) was added for colorimetric detection and color development was quenched with 1N HCl ...
-
bioRxiv - Immunology 2020Quote: ... Plates were developed with 1-step Ultra TMB-ELISA (ThermoFisher), reaction stopped by 2M H2SO4 and read at 450nm.
-
bioRxiv - Immunology 2020Quote: ... ELISA substrate (1-step Ultra TMB, Thermo Scientific cat# 34028) was added ...
-
bioRxiv - Immunology 2020Quote: ... and developed with 1-Step Turbo TMB ELISA Substrate (ThermoFisher) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 1-Step™ Ultra TMB-ELISA Substrate Solution (Thermo Scientific) was incubated on the plate for 10 minutes in the dark and then quenched with 1 M H2SO4 ...
-
bioRxiv - Microbiology 2023Quote: ... and 1-Step™ TMB ELISA Substrate Solutions (Thermo Scientific) were added to the plates and detected by a Perkin Elmer EnSpire multimode plate reader.
-
bioRxiv - Developmental Biology 2021Quote: ... rat anti-mCherry (Thermo Fisher, M11217, 1:500), rabbit anti-Halotag (Promega ...
-
bioRxiv - Developmental Biology 2021Quote: ... goat anti-rat Alexa546 (1:500; Invitrogen A11081) and TRITC-phalloidin (1:100 ...
-
bioRxiv - Developmental Biology 2019Quote: ... AlexaFluor-568 anti-rat (1/300; A11077, Invitrogen). Nuclei were counterstained with DAPI (1:10,000 ...
-
bioRxiv - Genetics 2021Quote: ... Ki67 (1:1000, rat, Invitrogen #14-5698-82), TUJ1 (1:2000 ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-rat (1:3000; Molecular Probes, Invitrogen) or anti-chicken ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-rat (1:3000; Molecular Probes, Invitrogen) or anti-chicken ...
-
bioRxiv - Neuroscience 2021Quote: ... or rat anti-mCherry (1:500, Invitrogen, M11217) in 1.5% NGS blocking solution with 0.1% Triton X-100 ...