Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Rat Eukaryotic Translation Initiation Factor 4E Binding Protein 1 EIF4EBP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and the murine housekeeping gene eukaryotic translation elongation factor-1α (EF1a; assay ID: VB1-14428-VT, Affymetrix, Inc.), that shares 95% sequence identity with the Syrian hamster ...
-
bioRxiv - Microbiology 2021Quote: ... in vitro synthesized guide RNA (sgRNAs) that were designed to cut shortly after the translation initiation codon in Ajuba Exon 1 were ordered from ThermoFisher’s sgRNA service (CCGGAGTCCGAGAGTCTCAACTT) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... a Rat bFGF ELISA Kit (Invitrogen, CA), and an AssayMax™ Dihydrotestosterone ELISA Kit (Assaypro ...
-
bioRxiv - Immunology 2021Quote: Maxisorp high protein binding 96 well ELISA plate (Nunc, Thermo Fisher Scientific.) was coated with 2μg/mL goat anti-human Fc antibody (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: Maxisorp high protein binding 96 well ELISA plate (Nunc, Thermo Fisher Scientific.) was coated with 2μg/mL goat anti-human Fc antibody (Thermo Fisher Scientific ...
-
Activation of glucocorticoid receptor signaling inhibits KSHV-induced inflammation and tumorigenesisbioRxiv - Cancer Biology 2023Quote: ... ELISA was performed using the rat IL-1α ELISA Kit (Invitrogen, BMS627) and IL-1Ra ELISA Kit (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... High-binding ELISA plates (Thermo Scientific) were coated with capture antibody and incubated overnight at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... MaxiSorp high binding ELISA plates (Nunc) were coated with 100 μL/well of 1 μg/mL recombinant SARS-CoV-2 protein in PBS ...
-
bioRxiv - Immunology 2021Quote: ... MaxiSorp high binding ELISA plates (Nunc) were coated with 100 μL per well of 1 μg mL−1 recombinant SARS-CoV-2 protein with the pre-fusion stabilized conformation in PBS ...
-
bioRxiv - Immunology 2022Quote: ... MaxiSorp high-binding ELISA plates (NUNC) were coated with 10μg/mL Spike protein in PBS (50mL per well) ...
-
bioRxiv - Biochemistry 2023Quote: ... MaxiSorp high binding ELISA plates (Nunc) were coated with 100□μl/well of 1□μg/ml highly purified SARS-CoV-2 SARS-CoV-2 RBDs ...
-
bioRxiv - Neuroscience 2022Quote: ... Serum TNF and IL-1β concentrations were determined by using a rat TNF alpha Uncoated ELISA and a rat IL-1β ELISA Kit (all from Invitrogen) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: Hypoxia-inducible factor 1-alpha (HIF-1α) was evaluated using a HIF-1 Alpha ELISA Kit (Invitrogen™). Procedure steps were followed according to the manufacturer’s instructions and results were monitored at 450 nm using a microplate reader (iMARK™ ...
-
bioRxiv - Immunology 2022Quote: ... High-binding 96-well ELISA plates (Nunc) were coated with anti-mouse IL-10 (eBioscience ...
-
bioRxiv - Microbiology 2020Quote: High-binding 96-well ELISA plates (Nunc) were coated with 0.5 µg/well of purified SARS-CoV-2 N protein in carbonate/bicarbonate buffer 0.05 M pH 9.6 and allowed to bind over night at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Translation activity at the midbody was assessed by detecting protein synthesis level using an L-HPG-translation kit (ThermoFisher, Cat# C10429) as previously described 44 ...
-
bioRxiv - Microbiology 2023Quote: ... The high protein-binding capacity 96 well ELISA plate (Nunc MaxiSorp® flat-bottom, Invitrogen) was coated with ELISA capture antibody ...
-
bioRxiv - Microbiology 2023Quote: ... The high protein-binding capacity 96 well ELISA plate (Nunc MaxiSorp® flat-bottom, Invitrogen) was coated with ELISA capture antibody ...
-
bioRxiv - Plant Biology 2022Quote: The 5 kbp putative promoter fragment upstream of the translation initiation codon of each gene was cloned into pENTR4 dual-selection vector (Thermo Fisher SCIENTIFIC, USA) using an In-Fusion HD cloning kit ...
-
bioRxiv - Cancer Biology 2021Quote: The cell membrane protein samples were collected using Mem-PER eukaryotic membrane protein extraction reagent kit (Thermo Scientific, 89826, MA) according to the protocol instruction ...
-
bioRxiv - Physiology 2024Quote: ... Initiation media contained 1% bovine serum albumin (Thermofisher™, B14) ...
-
bioRxiv - Cancer Biology 2023Quote: ... with the Mouse Monocyte Chemoattractant Protein-1/CCL2 (MCP-1) Uncoated ELISA Kit (ThermoFisher) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: Protein samples from in vitro translation experiments were quantified with a Qubit Protein Assay kit (Thermo Scientific), mixed with 6x SDS Laemmli reducing buffer (Alfa Aesar) ...
-
bioRxiv - Molecular Biology 2019Quote: ... for unperturbed samples or RiboMinus Eukaryotic Kit v2 (ThermoFisher, A15020) for PlaB/DMSO samples ...
-
bioRxiv - Immunology 2024Quote: ... To enrich for MCL-1 binding protein immunoprecipitation was preformed using the Dynabeads Protein G IP Kit (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: High binding ELISA plates (07-200-37, Fisher Scientific) were coated with 1 μg/mL of labeled and blocked with 2% BSA in PBS ...
-
bioRxiv - Immunology 2021Quote: ... high binding ELISA plates (07-200-37, Fisher Scientific) were coated with 1 μg/mL trimer and blocked with 2% BSA in PBS ...
-
bioRxiv - Immunology 2022Quote: ... 96-well high-binding ELISA plates (Thermo Fisher Scientific) were coated overnight at 4 °C with 100 μL of 0.8 μg/mL (80 ng/well ...
-
bioRxiv - Immunology 2022Quote: ... 96–well high-binding ELISA plates (Thermo Fisher Scientific) were coated overnight at room temperature (RT ...
-
bioRxiv - Immunology 2023Quote: ... high-binding ELISA plates (07-200-37, Fisher Scientific) were coated with 1 mg/ml trimer and blocked with 2% BSA in PBS overnight ...
-
bioRxiv - Immunology 2021Quote: ... RBD binding inhibition was measured using a SARS-CoV-2 Neutralizing Ab ELISA Kit (Invitrogen). For anti-Spike IgG experiments ...
-
bioRxiv - Cell Biology 2019Quote: In vitro mRNA transcription and protein translation was performed using mMessage SP6 transcription kit (Ambion) and rabbit reticulocyte lysate system (Promega ...
-
bioRxiv - Pathology 2020Quote: ... Eukaryotic 18S rRNA (Life Technologies) and 28S (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... Eukaryotic 18S rRNA (Life Technologies) was endogenous control for normalization of the target RNAs.
-
bioRxiv - Molecular Biology 2024Quote: ... total RNA was used after ribodepletion (Ribominus eukaryotic kit v2; ThermoFisher) and fragmentation (25 min at 94 °C in 2X T4 PNK reaction buffer from NEB –140 mM Tris-HCl pH 7.6 ...
-
bioRxiv - Cell Biology 2022Quote: In vitro translation was performed using the One Step In Vitro Translation Kit (Thermo Scientific). Target proteins were cloned into pT7CFE1-NHA vector (with N-terminal HA tag ...
-
bioRxiv - Neuroscience 2020Quote: Levels of total APOE protein were analysed by Human ELISA Kit from Invitrogen (Apolipoprotein E Human ELISA Kit). Levels of Aβ were analysed by ELISA (Human β Amyloid 42 ELISA Kit Wako high sensitive #298-64401 and Human β Amyloid 40 ELISA Kit Wako #298-64601 ...
-
bioRxiv - Cancer Biology 2023Quote: ... after fixation/permeabilisation using the Foxp3 transcription factor binding/permeabilization diluent and concentrate kit (Ebioscience, Thermofisher scientific)
-
bioRxiv - Neuroscience 2021Quote: ... streptavidin biotin-binding protein (Streptavidin Alexa 488, 1:500, Invitrogen) was diluted in 5% BSA with 5% NGS and 0.3% Triton-X overnight at 4 °C ...
-
Complement-associated loss of CA2 inhibitory synapses in the demyelinated hippocampus impairs memorybioRxiv - Neuroscience 2021Quote: ... Streptavidin biotin-binding protein (Streptavidin Alexa 488, 1:500, Invitrogen) was diluted in 5% BSA with 5% NGS and 0.3% Triton-X overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... protein-binding plates (Nunc Maxisorp) were coated with rMOG (housemade ...
-
bioRxiv - Immunology 2021Quote: ... was coated onto each wells of Nunc maxisorp high protein-binding 96 well ELISA plate (Thermo Fisher Scientific Inc.) and incubated overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... Ribosomal RNA was depleted using the eukaryotic Ribo-minus kit (Ambion, A15017). Ligation of 5’ linker ...
-
bioRxiv - Microbiology 2020Quote: ... eukaryotic 18S assay (Hs99999901_s1, Applied Biosystems, Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... using nick translation kit (Molecular Probes, Cat# AF594). The samples were denatured 90 °C for 12 min ...
-
bioRxiv - Microbiology 2022Quote: IL-8 and IL-1β cytokines were quantified by ELISA using the Rabbit IL-1 beta ELISA Kit and Rabbit IL-8 ELISA Kit (Invitrogen). Aliquots of 2 mL of lung homogenate shred in saline solution were centrifuged during 30 min at 10 000 rpm and 4°C ...
-
bioRxiv - Immunology 2021Quote: High binding ELISA plates (Thermo Scientific, catalog no 44-2404-21) were coated at 0.5µg/mL with goat anti-mouse IgG2b (Southern Biotech ...
-
bioRxiv - Immunology 2020Quote: ... Nunc high-binding ELISA plates (Thermo Fisher Scientific; Waltham, MA, USA) were coated with 2 μg/ml of recombinant SARS-CoV-2 proteins (S1 and RBD-His proteins were produced in the lab and S1 +S2 ECD spike protein was purchased from Sino Biologicals ...
-
bioRxiv - Immunology 2023Quote: ... 96-well high-binding ELISA plates (Nunc A/S, Roskilde, Denmark) were coated overnight at 4ºC with 100 μL of 0.45 μg/mL Spike protein ...
-
bioRxiv - Microbiology 2020Quote: ... gH/gL or gL (diluted in PBS; 100 µl/well) were coated overnight on Nunc MaxiSorp high protein-binding capacity ELISA plates (ThermoFisher). Subsequently ...