Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for Rat Epithelial Discoidin Domain Containing Receptor 1 DDR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... and an ICAM1 exon 2 (Ig domain 1)-targeting TrueGuide sgRNA (Invitrogen; sequence: CCACAGTTCTCAAAGCACAG) according to the manufacturer’s U2OS protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... mouse anti-transferrin receptor (Invitrogen, catalogue number 13–6800; WB 1:1000), rabbit anti-Stim1 (Cell Signalling Technology ...
-
bioRxiv - Genetics 2019Quote: ... mouse anti-transferrin receptor (1:500; clone H68.4; #13-6800, Thermo Fisher), and rabbit anti-calnexin (1:250 ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-progesterone receptor (catalog no. RM-9102-S0, 1:400, Thermo Scientific) and anti-TER-119 (catalog no ...
-
bioRxiv - Cell Biology 2022Quote: ... Insulin Receptor β CT-3 mouse monoclonal antibody (1:1000, AHR0271, ThermoFisher), Perilipin-1/PLIN1 D1D8 rabbit monoclonal antibody (1:1000 ...
-
bioRxiv - Immunology 2022Quote: ... ELISA was developed with 50uL TMB (1-Step Ultra TMB-ELISA, Thermo Fisher, Waltham, MA, USA) for 10 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... signals of both ELISAs were visualized using 1-step Ultra TMB ELISA substrate (Fisher Scientific 34028), an incubation period at RT and addition of 2 M sulfuric acid as the stop reagent ...
-
bioRxiv - Developmental Biology 2022Quote: ... rat anti-CD45 (1:200; Invitrogen), and rat anti-CD4 (1:100 ...
-
bioRxiv - Neuroscience 2020Quote: ... rat anti-PlexinB2 (Invitrogen, 1:100), rabbit anti-Alcaline Phosphatase (Gene hunter ...
-
bioRxiv - Microbiology 2021Quote: ... rat anti-mCherry (1:1000, ThermoFisher), and mouse anti-Flag (1:1000 ...
-
bioRxiv - Systems Biology 2021Quote: ... rat (Invitrogen; 31470; 1:5000 dilution), and rabbit IgG (Cell Signaling ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1:200 anti-Rat-Alexa568 (ThermoFisher) for SIM ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-rat-HRP 1:5000 (Invitrogen), mouse anti-tubulin 1:5000 ...
-
bioRxiv - Cell Biology 2022Quote: ... or rat tail collagen 1 (GIBCO). Cells were then treated as indicated and images were recorded with an Olympus IX71 microscope with 60x oil objective (Olympus) ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-mCherry (1:1000, rat; Invitrogen), and anti-DsRed (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-Sox2 (1:400; Invitrogen), mouse anti-glial fibrillary acidic protein (GFAP ...
-
bioRxiv - Cell Biology 2023Quote: ... or rat tail collagen 1 (GIBCO). Cells were then treated as indicated and images were recorded with an Olympus IX71 microscope with 60x oil objective (Olympus) ...
-
bioRxiv - Cell Biology 2023Quote: ... Rat anti-mCherry (1:1000, Invitrogen), and rabbit anti-GFP (1:10,000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... rat anti-Tbr2 (1:1000; Invitrogen), mouse anti-β catenin (1/1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... anti-rat (Invitrogen #A11006; 1:250), anti-rabbit (Invitrogen #A31573 ...
-
bioRxiv - Neuroscience 2024Quote: ... rat anti-GFAP (1:500, Invitrogen), guinea pig anti-Doublecortin (1:1000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were analyzed in duplicates using Monkey IL6 ELISA and Monkey TNFα Total ELISA kits (ThermoFisher, Waltham, MA) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Total mouse tau ELISA measurements were carried out using a total mouse tau ELISA kit (Thermo Fisher Scientific) according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: Total tau content was quantified in brain extracts by ELISA (Human Tau (total) ELISA kit (#KHB0041, Invitrogen, UK), see supplementary methods ...
-
bioRxiv - Neuroscience 2021Quote: ... and anti-transferrin receptor (Invitrogen). For the screening of compounds with the potential to rescue GlyT2 defective phenotypes the following chemicals were used ...
-
bioRxiv - Cell Biology 2023Quote: ... Transferrin receptor (Invitrogen, 13-6890), NHE5 (PA5-37222) ...
-
Microbial signals and lymphotoxin drive TNF-independent death of A20 and ABIN-1 deficient epitheliumbioRxiv - Immunology 2021Quote: ... and 1-Step Ultra TMB-ELISA (ThermoFisher Scientific).
-
bioRxiv - Immunology 2020Quote: ... 1-Step Ultra TMB-ELISA Substrate Solution (ThermoFisher) was added and incubated at room temperature for either 15 minutes (V3 peptides ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 Step Ultra-ELISA TMB substrate (ThermoFisher).
-
bioRxiv - Cancer Biology 2024Quote: ... Substrate (1-Step Ultra TMB-ELISA; ThermoFisher Scientific) was added for 10 min and reactions were stopped with the addition of 1M sulfuric acid (final) ...
-
bioRxiv - Immunology 2024Quote: ... 1-Step Ultra TMB-ELISA substrate solution (ThermoFisher) was added to develop for 5 minutes and quenched with 2N sulfuric acid (VWR) ...
-
bioRxiv - Molecular Biology 2021Quote: ... This oligo was annealed and amplified to a fixed 91nt oligo containing the scaffold domain using Taq polymerase (Invitrogen, Cat. #10342046). Transcription was performed using Hi-SCribe T7 ...
-
bioRxiv - Cell Biology 2021Quote: ... blocked in 3% normal donkey serum/0.25% Triton X-100 in PBS for 1 h at room temperature and then incubated overnight at room temperature in blocking solution containing primary antiserum (rat anti-mCherry, Invitrogen M11217, 1:1,000; chicken anti-GFP, Life Technologies A10262 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were suspended in a solution of DMEM without phenol red containing 10% rat serum and 1% low-melt agarose (Invitrogen) in a glass capillary tube ...
-
bioRxiv - Cell Biology 2020Quote: ... Released IL-1β was quantified using the Human IL-1 beta ELISA Ready-Set-Go! Kit (ThermoFisher) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... or PAF (4 μM) with or without sAGP-1 using competitive ELISA kit (EMSCAMPL, Invitrogen, Vienna, Austria). This system displays a detection sensitivity of 0.39 pmol/ml of cAMP according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2020Quote: ... 100 μL of sample (diluted 1:100) was added to anti-HNE ELISA kit (Thermo Fisher Scientific) for 1 h at room temperature ...
-
bioRxiv - Immunology 2023Quote: IL-1β secretion was detected by IL-1 beta Mouse Uncoated ELISA Kit (88-7013-88; Invitrogen) following the manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: ... NPC1 C domain and NPC1 I domain) and the viral protein constructs were co-transfected using Lipofectamine 2000 (Invitrogen) following the manufacture instructions.
-
bioRxiv - Cell Biology 2020Quote: ... PDGF-AA ELISA kits (EHPDGF) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: Mouse IL-6 was quantified by uncoated ELISA Kit (ThermoFisher) according to manufacturer’s instruction.
-
bioRxiv - Pathology 2019Quote: ... The MCP-3 (Cat#: BMS6006INST) ELISA kit were from Invitrogen. The GCP-2 (Cat# ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... an interleukin-8 (IL-8) ELISA kit (Invitrogen, Catalog # CHC1303) to quantify secreted IL-8 levels in conditioned media ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Mouse ELISA Interleukin (IL)-6 kit was purchased from Invitrogen, Philippines ...
-
bioRxiv - Immunology 2022Quote: ... IL1β levels were measured using the IL1β ELISA kit (Invitrogen) according to manufacturer instruction ...
-
bioRxiv - Neuroscience 2020Quote: ... was measured with Human Aβ Ultrasensitive ELISA Kit (Invitrogen, #KHB3544).
-
bioRxiv - Immunology 2022Quote: ... following the manufacturer’s instructions (TNF beta Human ELISA Kit, ThermoFisher).
-
bioRxiv - Molecular Biology 2019Quote: ... The Human Erythropoietin Platinum ELISA kit (Affymetrix cat. no. BMS2035) was used as per manufacturer’s suggested protocol.
-
bioRxiv - Immunology 2021Quote: Human IL-2 Ready-SET Go! ELISA kit (eBioscience/Invitrogen) or Human TNF alpha ELISA Ready-SET-Go! (eBioscience/Invitrogen ...
-
bioRxiv - Immunology 2020Quote: Human IL-2 Ready-SET Go! ELISA kit (eBioscience/Invitrogen) or Human TNF alpha ELISA Ready-SET-Go! (eBioscience/Invitrogen ...