Labshake search
Citations for Thermo Fisher :
351 - 400 of 7789 citations for Rat BRSK1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... and rat anti-mCherry (1:2000, Invitrogen). After washing with PBS (3 x 5 min) ...
-
bioRxiv - Neuroscience 2023Quote: ... Rat anti-mCherry antibody (M11217, Life Technologies) together with chicken anti-Iba1 and rabbit anti-P2Y12 antibody were applied overnight at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... goat anti-rat 488 (Thermo Fisher A11006), donkey anti-mouse 647 (Thermo Fisher A31571) ...
-
bioRxiv - Cell Biology 2023Quote: ... and goat anti-rat (AF546, A11081, Invitrogen) antibodies ...
-
bioRxiv - Genetics 2023Quote: ... Alexa fluor 568 anti-Rat (Invitrogen, A11077),.
-
bioRxiv - Genetics 2023Quote: ... goat anti-rat (#21434 Invitrogen, 1:1000), goat anti-mouse Alexa Fluor Plus 555 (#A32727 Invitrogen 1:1,000) ...
-
bioRxiv - Immunology 2023Quote: ... donkey anti-rat (1:400; Invitrogen A21209); Alexa Fluor 488 goat anti-rat (1:400 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... then incubated with anti-rat FoxP3 (Invitrogen) for 30 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... don-key anti-rat 488 (Invitrogen A21208).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... a Rat bFGF ELISA Kit (Invitrogen, CA), and an AssayMax™ Dihydrotestosterone ELISA Kit (Assaypro ...
-
bioRxiv - Neuroscience 2023Quote: ... goat-anti rat (1:4000; 31470, Invitrogen), and goat-anti rabbit (1:4000 ...
-
bioRxiv - Microbiology 2023Quote: ... anti-rat AF647 (Invitrogen, A21247, 1:500), anti-chicken AF546 (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... collagen (Collagen I, Rat Tail, Gibco A1048301), or laminin (Roche 11243217001 ...
-
bioRxiv - Neuroscience 2023Quote: ... goat anti-rat IgG (1:1,000; Invitrogen), Alexa Fluor 488-conjugated goat anti-rabbit IgG or goat anti-mouse IgG (1:300 ...
-
bioRxiv - Cell Biology 2023Quote: ... Alexa Fluor 488 anti–rat (A11006; Invitrogen), Alexa Fluor 594 Phalloidin (A12381 ...
-
bioRxiv - Cell Biology 2023Quote: Type 1 rat-tail collagen (Life Technologies) was used at a stock concentration of 3 or 10 mg mL-1 ...
-
bioRxiv - Neuroscience 2024Quote: ... and Rat Alexa fluor 647 (Thermo Fisher Scientific Cat# A21247 ...
-
bioRxiv - Neuroscience 2024Quote: ... Donkey anti-Rat 647 IgG (#A21247, ThermoFisher).
-
bioRxiv - Neuroscience 2024Quote: ... Donkey anti-Rat 488 IgG (#A21208, ThermoFisher), Donkey anti-Rat 555 IgG (#A21434 ...
-
bioRxiv - Neuroscience 2024Quote: ... Donkey anti-Rat 555 IgG (#A21434, ThermoFisher), Donkey anti-Rat 647 IgG (#A21247 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Goat anti-Rat IgG-AF647 (Invitrogen, A21247) and AF488-goat anti-mouse (A11017 ...
-
bioRxiv - Neuroscience 2024Quote: ... and rat cortical astrocytes (Gibco™, N7745100) were seeded at a density of 100 cells/mm2 ...
-
bioRxiv - Cell Biology 2024Quote: ... rat anti-alpha tubulin (MA1-80017, Invitrogen), and human anti-centromere protein antibody (Antibodies Incorporated) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Rat anti-E-cadherin 1:200 (DCAD2, DSHB) and donkey anti-rat Alexa 488 1:200 (Thermo Fisher Scientific) antibodies were used ...
-
bioRxiv - Immunology 2022Quote: ... the cells were stained with unconjugated rat anti-Ly49A antibody (YE1/32.8.5, Stemcell) followed by AF555 conjugated goat-anti-rat IgG (Life Technologies), both were done for 45 minutes in PBS at RT ...
-
bioRxiv - Microbiology 2023Quote: ... followed by a secondary anti-rat IgG antibody conjugated with Alexa Fluor 568 (anti-rat-AF568) (Thermo Fisher Scientific). Fluorescent images were captured with the CQ1 Confocal Quantitative Image Cytometer (Yokogawa Electric Corporation ...
-
bioRxiv - Developmental Biology 2022Quote: ... Rat TS cells were maintained in Rat TS Cell Stem State Medium (RPMI-1640 culture medium (11875093, Thermo Fisher) containing 20% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA from shRNA transduced C2C12 cells was extracted using RNAqueous®-Micro Total RNA Isolation Kit (ThermoFisher). 1 μg total RNA was used to generate one strand cDNA using the qScript™ cDNA Synthesis Kit (Quanta Biosciences) ...
-
bioRxiv - Microbiology 2019Quote: ... HeLa-CD4-shRNA-REAF were selected for resistance to puromycin in media supplemented with 10μg/ml puromycin (Invitrogen).
-
bioRxiv - Cancer Biology 2021Quote: ... MDA-MB-231 F2 cells were then infected with shRNA packaged within lentiviruses in Opti-MEM (Invitrogen 51985034) supplemented with 8µg/mL polybrene (Millipore TR-1003-G) ...
-
Myosin VI regulates ciliogenesis by promoting the turnover of the centrosomal/satellite protein OFD1bioRxiv - Cell Biology 2021Quote: ... pSLIK-NEO myosin VI shRNA was generated with Gateway™ LR Clonase™ II Enzyme mix (ThermoFisher Scientific) by subcloning a nucleotide sequence targeting myosin VI (5’- AGTAATTCAGCACAATATTCCAA - 3’ ...
-
bioRxiv - Microbiology 2022Quote: ... shRNAs targeting BUD23 or overexpressing ORF11-FLAG were seeded in triplicate in 12-well culture plates (Thermo Fisher) at a density of 3 × 105 cells per well and grown for 24 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... the short hairpin RNA (shRNA) for Nrg1 was designed using online BLOCK-iT™ RNAi Designer program (Invitrogen) and the shRNA sequences targeting neuregulin were ...
-
bioRxiv - Neuroscience 2023Quote: ... The ssDNA primers to generate the shRNAs were obtained using the Block-it RNAi web tool (Thermo Scientific) and were as follows ...
-
bioRxiv - Neuroscience 2021Quote: ... Plasmids were purified with HiPure Plasmid Maxiprep kits (Invitrogen).
-
bioRxiv - Cell Biology 2022Quote: Purified plasmids (GeneJET Plasmid Miniprep Kit, Thermo Scientific K0503) were microinjected into embryos of nos/attP40 flies for mVenus fusion gene construct injection and nos-Cas9 flies for CRISPR mutagenesis ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were isolated using GeneJet Plasmid Miniprep Kit (ThermoFisher).
-
bioRxiv - Bioengineering 2019Quote: ... and cryostat section (10μm) were stained using the following antibodies: rat anti-IL2 (eBioscience 14-7029-85) and anti-rat AlexaFluor488 (Invitrogen A21208). For vascular staining goat anti-CD31 (R&D AF3628 ...
-
bioRxiv - Bioengineering 2019Quote: Antigen expression was confirmed on ice-cold acetone fixed 8-μm cryostat sections of SKRC52 and CT26-CAIX stained with IL2-XE114-TNFmut and IL2-F8-TNFmut (final concentration 5μg/mL) and detected with rat anti-IL2 (eBioscience 14-7029-85) and anti-rat AlexaFluor488 (Invitrogen A21208). For vascular staining goat anti-CD31 (R&D AF3628 ...
-
bioRxiv - Biophysics 2020Quote: Primary rat cortical neurons (RCN) prepared from the cortex of day-18 rat embryos (A10840-01, Life Technologies, Gaithersburg, MD) were suspended in a culture medium (21103-049 ...
-
bioRxiv - Neuroscience 2022Quote: ... Serum TNF and IL-1β concentrations were determined by using a rat TNF alpha Uncoated ELISA and a rat IL-1β ELISA Kit (all from Invitrogen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Macrophages were positively enriched from spleen single-cell suspensions using anti-F4/80 antibody (rat, Bioscience, Clone T45-2342)-coated Dynabeads (anti-rat IgG, Invitrogen) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... Cells were then washed and incubated with anti-rat Ab magnetic beads at 1 bead/target cell for 40 min at 4C (Dynabeads sheep anti-rat IgG, Invitrogen). Cell suspensions were stained with Abs specific for congenic markers ...
-
bioRxiv - Immunology 2021Quote: ... Cells were then washed and incubated with anti-rat Ab magnetic beads at 1 bead/target cell for 40 min at 4C (Dynabeads sheep anti-rat IgG, Invitrogen). Cells were sorted into 3mL of complete media (RPMI 1640 ...
-
bioRxiv - Developmental Biology 2023Quote: ... using rat-anti-BrdU (1:500, OBT0030 Accurate) and donkey-anti-rat Alexa Fluor-568-conjugated secondary antibody (1:1000, Invitrogen).
-
bioRxiv - Developmental Biology 2021Quote: ... and goat anti-rat 568 (Invitrogen, cat #A11077) antibodies in a dark humidified chamber for one hour at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... and anti-rat conjugated to Alexa647 (Thermofisher, A21472). Alexa568 conjugated phalloidin (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... rat anti-mCherry (Thermo Fisher, M11217, 1:500), rabbit anti-Halotag (Promega ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and anti-rat Alexa 488 (Invitrogen, A-11006) (1 μg/mL) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and goat anti-rat 647 (#A-21247; Invitrogen). Nuclei were stained with DAPI (1:1000 ...