Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for Rat Alanine Glyoxylate Aminotransferase AGXT ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... IL-6 and IL-1β via ELISA kits (Thermo Fisher, MA, US) as per manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... T cell activation was assessed using mouse IL-2 ELISA kits (Invitrogen), with samples diluted 1:2 −1:20 for comparison to the standard curve ...
-
bioRxiv - Neuroscience 2022Quote: ... Aβ42 concentrations were measured using the Human Aβ42 ELISA kit (Thermo Fisher) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2019Quote: ... Serum insulin concentrations were measured with an ELISA kit (Invitrogen; Cat#KAQ1251) and Biotek ELx800 analyzer (Biotek Instruments ...
-
bioRxiv - Cancer Biology 2019Quote: ... using Human IFN gamma Uncoated ELISA Kit (Life Technologies 88-7316-22) and Human Granzyme B DuoSet ELISA (R&D DY2906-05) ...
-
bioRxiv - Neuroscience 2021Quote: Aβ42 levels were measured using a human Aβ42 ELISA kit (Thermo Scientific) following manufacturer instructions ...
-
bioRxiv - Physiology 2022Quote: Serum insulin was detected using a sandwich ELISA kit (Thermo Fisher, EMINS) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... and IgA concentration was measured by mouse IgA uncoated ELISA kit (Invitrogen) or mouse IgA ELISA Quantification Set (#E90-103 ...
-
bioRxiv - Cell Biology 2023Quote: ... IL-8 and TNF-α were measured using ELISA kits from Invitrogen (Catalog# BMS224-2 ...
-
bioRxiv - Cancer Biology 2023Quote: Mouse TNF-α uncoated ELISA Kit from Invitrogen (Ref 88-7324-22) was used according to manufacturer’s instructions to quantify TNF-α concentration in 2ml supernatants from confluent 6-wells of keratinocyte cultures after 24 h of incubation ...
-
bioRxiv - Bioengineering 2023Quote: Secreted progesterone was measured using the Progesterone Competitive ELISA Kit (Invitrogen #EIAP4C21). In brief ...
-
bioRxiv - Bioengineering 2023Quote: ... and IgG2c (Cat# 88-50670-22) ELISA kits were purchased from ThermoFisher Scientific and were used according to manufacturer’s instructions for the serum samples ...
-
bioRxiv - Neuroscience 2023Quote: ... ELISA kits (Cat. No. KHC0061, KAC1751, respectively, ThermoFisher Scientific, Waltham, MA, USA) were used following the manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... IL-18 was assayed using the IL-18 Mouse ELISA Kit (Invitrogen) according to the instructions.
-
bioRxiv - Microbiology 2023Quote: ... Leptin levels were determined using Human Leptin Instant ELISA kit (Invitrogen BMS2039INST) according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... PBS and ELISA kits (TNFa and IL-6) were purchased from Invitrogen. MTT (M2128 ...
-
bioRxiv - Developmental Biology 2022Quote: ... the AbC anti-rat/hamster compensation bead kit (Life Technologies) was used ...
-
bioRxiv - Cell Biology 2019Quote: ... including HindIII restriction sites and alanine linker sequence was synthesized by GeneArt (Thermo Fisher Scientific, UK): AAGCTTTATTAAAATGATTTCTCGTGTTTTTTCCCGTTCATTAGCATCAGCTGCC AAGTCTACCAAACCACCAATCCAATTGTTTGGTATTGATGCAGCTGCAGCTGCA GCAAGCTT ...
-
bioRxiv - Immunology 2021Quote: ELISA plates (Nunc, MaxiSorp ELISA plates ...
-
bioRxiv - Microbiology 2019Quote: ... ELISA plates (Thermofisher) were coated with 100 µl of supernatants and incubated overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... ELISA plates (Nunc MaxiSorp™ flat-bottom ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates (Nunc Maxisorp ...
-
bioRxiv - Microbiology 2020Quote: ... ELISA substrate (Invitrogen) was added to the plates ...
-
bioRxiv - Immunology 2020Quote: ... TNFα ELISA (Invitrogen) were performed according to manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... ELISA plates (Nunc MaxiSorp ...
-
bioRxiv - Immunology 2020Quote: ELISA plates (Nunc MaxiSorp ...
-
bioRxiv - Immunology 2022Quote: ELISA plates (Nunc MaxiSorp ...
-
bioRxiv - Immunology 2024Quote: ... ELISA plates (Nunc) were coated with goat anti-mouse Ig (SouthernBiotech ...
-
bioRxiv - Cell Biology 2020Quote: ... HIF1A levels were measured in duplicates applying a HIF1A Human ELISA kit (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... HI sera were tested using PrioCHECK PRRSV Antibody ELISA Kit (Thermo Fisher Scientific) for detection of PRRSV N protein-specific antibodies ...
-
bioRxiv - Cell Biology 2020Quote: ... and murine IL-6 were measured using commercial ELISA kits obtained from Invitrogen, Thermo Fisher Scientific (Lower detection limits ...
-
bioRxiv - Genomics 2021Quote: ... aldosterone levels in the supernatant were measured using Aldosterone Competitive ELISA kit (ThermoFisher) and cell viability measured from the cells using PrestoBlue reagent (ThermoFisher ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The ELISA was performed using Human IL-1β high sensitivity kit from Invitrogen Inc ...
-
bioRxiv - Neuroscience 2020Quote: ... Aβ level was determined using the ELISA kit following manufacturer’s instructions (ThermoFisher Scientific). The Aβ level is normalized with total protein level and represented as relative fold change over control.
-
bioRxiv - Cell Biology 2021Quote: ... CREB levels (total/phosphorylated) were measured using a CREB InstantOne ELISA kit (Invitrogen) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... IFN-γ and IL-17A were measured with uncoated ELISA kits from Invitrogen in accordance with manufacturer’s recommendations.
-
bioRxiv - Bioengineering 2022Quote: ... Albumin secretion was quantified using Human Albumin (ALB) ELISA Kit (EHALB, Invitrogen, CA) according to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2022Quote: ... Quantification of soluble Aβ peptide was performed using an ELISA kit (Thermofisher, KHB3441).
-
bioRxiv - Immunology 2022Quote: Mouse serum IgG and IgG2a were detected using commercially available ELISA kits (ThermoFisher) as per manufacturers’ instructions ...
-
bioRxiv - Immunology 2022Quote: ... or IL-2 Mouse Uncoated ELISA Kit (Thermo Fisher Scientific, 88-7024-76) following the manufacturer’s instructions ...
-
bioRxiv - Pathology 2020Quote: ... K562dif K562−28(A>G) dif we used Tetramethylbenzidine(TMB) Elisa Kit (Invitrogen) .105 cells from each of the test and control groups were resuspended in phosphate buffered saline (PBS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The ELISA was performed using Human IL-1β high sensitivity kit from Invitrogen. The sample of ELISA used in the present study consist of cell culture media (referred to as sample hereafter ...
-
bioRxiv - Cell Biology 2021Quote: ... Adiponectin was measured using an ELISA kit from Invitrogen (Catalog number: EZMADP-60K). Serum insulin levels were measured using ALPCO Mouse Insulin ELISA Jumbo kit (Cat ...
-
bioRxiv - Immunology 2020Quote: ... Antibodies were isotyped using the Rapid ELISA Mouse mAbs Isotyping Kit (ThermoFisher Pierce) with anti-mouse heavy chain capture antibody (anti-IgG1 ...
-
bioRxiv - Immunology 2021Quote: Cytokine concentration was measured by using IL-6 Mouse Uncoated ELISA Kit (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: mMCPT-1 was detected using the MCPT-1 mouse uncoated ELISA kit (ThermoFisher) following the protocol provided by manufacturer ...
-
bioRxiv - Molecular Biology 2022Quote: ... or PBS control was done using the SIgA Mouse Uncoated ELISA kit (Invitrogen) following manufacturer’s instructions ...
-
A conserved isoleucine in the binding pocket of RIG-I controls immune tolerance to mitochondrial RNAbioRxiv - Immunology 2022Quote: IFN-α levels were analyzed with commercial ELISA assay kits (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... and by the IL-27 Mouse ELISA kit (Thermo Fisher Scientific, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: Secreted APOE was measured using human APOE ELISA kit (Thermo Fisher Scientific, EHAPOE) following manufacturer’s instructions ...