Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for Progesterone Receptor PGR Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: ... Detailed immunohistochemistry staining and quantification procedures for each marker have been published (6, 16–26) or are in preparation for estrogen receptor alpha (antibody SP1; Thermo Scientific, Waltham, MA) and an antibody (PPG5/10 ...
-
bioRxiv - Neuroscience 2023Quote: ... the ATTO labeled surface-GluA1 receptors were labeled with Alexa Fluor Plus 647 conjugated anti-Rabbit IgG Secondary Antibody (1:200, Thermo Scientific A32733, AB_2633282) for 1h at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... rat Taste receptor type 1 member 3 (Tas1r3, Rn00590759_g1, Applied Biosystems) and rat Taste receptor ...
-
bioRxiv - Molecular Biology 2020Quote: ... The monoclonal mouse anti-ryanodine receptor (RyR, MA3-916, Thermo Fisher) primary antibody was incubated overnight (4 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-Transferrin receptor mAb (clone H68.4, Invitrogen, no. 13-6800,), rat anti-HA-tag mAb (clone 3F10 ...
-
bioRxiv - Neuroscience 2020Quote: ... and estrogen receptor α (ERα; 1:100; MA513304; Thermo Fisher, USA). Sections were incubated overnight at room temperature with primary antibody against estrogen receptor β (ERβ ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-NMDA receptor subunit 1 (1:1000, ThermoFisher PA3-102), and chicken anti-tyrosine hydroxylase (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... For the muscimol session a GABAA receptor agonist (Life Technologies Solutions) was used ...
-
bioRxiv - Neuroscience 2022Quote: ... Oligonucleotide primers for the GnRH receptor (Gnrhr) (Life Technologies, Table 1) gene were used to amplify gene-specific transcripts by quantitative PCR (qPCR) ...
-
bioRxiv - Neuroscience 2023Quote: ... interleukin 6 soluble receptor (Thermo Fisher Scientific, Waltham, USA, Cat # BMS214) and interleukin 13 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... and 2% v/v Fc receptor binding inhibitor (Thermo Fisher Scientific)) ...
-
bioRxiv - Immunology 2023Quote: HeLa cells were transfected with receptor plasmids using Lipofectamine 3000 (Invitrogen) for 24 hrs ...
-
bioRxiv - Immunology 2019Quote: ... to block non-specific binding of antibodies to Fc Receptors and then incubated at 4°C for 30 minutes with anti-CD45-PE (1:300, Thermofisher Scientific, Clone 30-F11), anti-LY6G-V450 (1:300 ...
-
bioRxiv - Biochemistry 2020Quote: ... mouse anti-transferrin receptor (Invitrogen, catalogue number 13–6800; WB 1:1000), rabbit anti-Stim1 (Cell Signalling Technology ...
-
bioRxiv - Genetics 2019Quote: ... mouse anti-transferrin receptor (1:500; clone H68.4; #13-6800, Thermo Fisher), and rabbit anti-calnexin (1:250 ...
-
bioRxiv - Biophysics 2019Quote: ... the cDNAs of receptors were subcloned into a modified pfastbac1 vector (Invitrogen), which contained an expression cassette with a haemagglutinin (HA ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-transferrin receptor (13-6800, Invitrogen; WB,1:1000, IF,1:200), Transferrin 488(T13342 ...
-
bioRxiv - Biophysics 2023Quote: Transient expression of receptors was achieved by using Lipofectamine LTX Plus (Invitrogen), transfecting 0.3 pmol plasmid DNA per 6-cm2 dish.
-
bioRxiv - Microbiology 2020Quote: ... Toll-like Receptor (TLR) 4 (Thermo Fisher Scientific, Waltham, MA, USA, 1:2000), TLR7 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... conditioned media enriched in individual receptors was prepared in Expi293F cells (Thermo Fisher), transiently transfected with receptors expressed as ectodomains fused to a human Fc (IgG1) ...
-
TNFR1/p38αMAPK signaling in Nex+ supraspinal neurons regulates sex-specific chronic neuropathic painbioRxiv - Neuroscience 2023Quote: ... N-methyl-D-aspartate receptor 1 (NMDAR1, rabbit, 1:1000, Invitrogen PA5-34599), N-methyl-D-aspartate receptor 2B (NMDAR2B ...
-
bioRxiv - Immunology 2022Quote: ... Selection for the KIR-CD3ζ receptor was performed by increasing the puromycin (Invitrogen) concentration to 1.0 µg/ml over 3-4 weeks and then maintaining at 0.5 µg/ml ...
-
bioRxiv - Immunology 2023Quote: ... THP-1 receptor cells were stained with CellTrace Violet (Thermo Fisher Scientific #C34557) at a final concentration of 1 μM in PBS for 20 minutes ...
-
bioRxiv - Immunology 2022Quote: ... and binding to Fc receptors was blocked using CD16/CD32 (clone 93, eBioscience/ThermoFisher). Cell numbers were calculated using counting beads (123count eBeads ...
-
bioRxiv - Bioengineering 2020Quote: ... while acetylcholine receptors were detected by a-bungarotoxin (Alexa Fluor 488®, Invitrogen # B13422). Nuclei were stained with 300 nM DAPI (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse monoclonal anti-transferrin receptor (clone H68.4 catalog no. 13-6800, Thermo-Fisher Scientific); mouse monoclonal anti-tubulin (clone DM1A ...
-
bioRxiv - Physiology 2019Quote: ... Protein homogenates were analyzed for abundance of phosphorylated(Tyr972)-insulin receptor (Invitrogen: 44-800G), insulin receptor-β (Cell Signaling ...
-
bioRxiv - Cancer Biology 2021Quote: ... rabbit anti-GABA A Receptor α6 (1:1000 dilution; Cat. #. PA5-77403, GABRA6; Invitrogen), and a-Tubulin (1:5000 dilution ...
-
bioRxiv - Immunology 2020Quote: ... Fc receptors were blocked prior to staining using anti-CD16/32 (93, ThermoFisher Scientific). Where >1 brilliant violet or brilliant UV dye was used concurrently ...
-
bioRxiv - Immunology 2022Quote: ... followed by Fc-receptor blockade with anti-CD16/CD32 (Thermo Fisher #14-0161-85), and then stained for 30 min on ice with the following antibodies in flow cytometry staining buffer (FACS) ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with anti-CD16/CD32 (diluted 1:50, Thermo Fisher Scientific) and cells were stained with cell surface antigens ...
-
Chimeric Antigen Cytotoxic Receptors for In-Vivo Engineering of Tumor-targeting Natural Killer CellsbioRxiv - Immunology 2023Quote: Huh7 cells were transfected with receptor mRNA using the Lipofectamine™ MessengerMAX™ (Invitrogen) mRNA transfection reagent ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Human V1A Receptor-CHO cell line (CHO -V1a) was cultured in Ham’s F12 (Life Technologies) supplemented with 10% fetal bovine serum (Life Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... nuclei were incubated with Polyclonal Glucocorticoid Receptor (2 ug; clone PA1-511A, Thermo Fisher Scientific) followed by Donkey anti-Rabbit IgG AF647 (0.5ug ...
-
bioRxiv - Immunology 2022Quote: ... Fc-receptors were blocked with anti-mouse CD16/CD32 (20 µg/ml, clone 93; Invitrogen) for 20min ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cells were stained with human FITC conjugated transferrin receptor (CD71; ThermoFisher: 11-0719-42) and human FITC conjugated glycophorin A (CD235a ...
-
bioRxiv - Neuroscience 2020Quote: ... IgG1 anti-transferrin receptor (TfR, clone H68.4, 1:500, ThermoFisher Scientific, catalog no. 13-6800), IgG1 anti-GAPDH (1:10,000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... recombinant GR-LBD-GST (A15668) and Nuclear Receptor Buffer F (PV4547) were all from Invitrogen.
-
bioRxiv - Bioengineering 2021Quote: ... platelet-derived growth factor receptor A (PDGFRA) and type I collagen (COL1A1) (Thermo Fisher, Waltham, Massachusetts). Probe references ...
-
bioRxiv - Immunology 2022Quote: ... HEK 293T cells expressing ACE2 receptors were suspended using TrypLE Select Enzyme solution (Thermo Fisher Scientific) and immediately added to all wells (10,000 cells in 100 μl of growth medium per well) ...
-
bioRxiv - Immunology 2020Quote: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax ...
-
bioRxiv - Neuroscience 2021Quote: ... surface receptors were labeled with Pierce™ Premium Grade Sulfo NHS-SS-Biotin (Thermofisher, Waltham, USA) and purified using Streptavidin High Performance Spintrap™ (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: Receptor and chemokine baculovirus stocks were produced using the Bac-to-Bac Baculovirus Expression System (Invitrogen). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: Stably expressing 5-HT receptor Flp-In 293 T-Rex Tetracycline inducible system (Invitrogen, mycoplasma-free) were used for calcium flux assays ...
-
bioRxiv - Evolutionary Biology 2023Quote: The chemicals used for the deorphanization of receptors were obtained from Acros Organics (Morris, NJ, USA), Alfa Aesar (Ward Hill ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then transiently transfected with receptor constructs using LipofectamineTM 2000 transfection system (ThermoFisher, cat# 11668019). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: ... and IGF-1 receptor (Catalog number: AM51331, siRNA ID:110754) with Lipofectamine RNAiMax Transfection Reagent (Invitrogen), according to manufacturer’s established protocol ...
-
bioRxiv - Microbiology 2020Quote: ... cells expressing the surface CD4 receptor were enriched using the Dynabeads CD4 cell isolation kit (Life Technologies). They were seeded to develop single cell-derived clones ...
-
bioRxiv - Microbiology 2021Quote: ... JCRB #1818) cells expressing the ACE2 or ACE and TMPRSS2 receptors respectively were cultured in DMEM (Gibco) supplemented with 5 % FBS (Fetal Bovine Serum) ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were transfected with pCMV6 vectors bearing WT or mutant receptors using Lipofectamine 3000 transfection reagent (Invitrogen). Following 24 h culturing ...