Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Piggybac Transposable Element Derived 3 PGBD3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... mESCs were co-transfected with 4 μg of transposable vector and 1 μg of the piggyBac transposase using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: Female mESCs were co-transfected with 3 μg piggybac transposase and 500 ng of the modified Wt1-SALL1-piggyBac-Neo-BAC using Lipofectamine LTX (Invitrogen), as described in a previous publication49 ...
-
bioRxiv - Neuroscience 2022Quote: ... The following day 0.5 µg of NOTCH3 EGF1-5 WT and R133C plasmids containing the piggyBac transposon and 0.2 µg of piggyBac transposase were transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... In vitro derived PCs were stained with CellEvent Caspase 3/7-Green (ThermoFisher), tetrametylrhodamine ...
-
bioRxiv - Developmental Biology 2024Quote: ... Goat-derived secondary antibodies (all obtained from Invitrogen, Thermofisher Scientific) were used in 1:300 dilution in PBS containing 5% BSA ...
-
bioRxiv - Developmental Biology 2024Quote: ... Goat-derived secondary antibodies (all obtained from Invitrogen, Thermofisher Scientific) were used in 1:300 dilution in PBS containing 5% BSA ...
-
bioRxiv - Molecular Biology 2020Quote: ... PiggyBac expression vectors were co-lipofected together with PiggyBac transposase plasmid (hyPBase, (Yusa et al., 2011)) with Lipofectamine 3000 (Thermo Fisher).
-
bioRxiv - Microbiology 2022Quote: ... then secondary antibody added (HRP-conjugated, goat derived; ThermoFisher, 62-6520). Following binding of the HRP-conjugated antibody ...
-
bioRxiv - Microbiology 2021Quote: 3 μg of in vitro-transcribed RNA derived from the pCrPV-3 or chimeric clones was transfected into 3 × 106 S2 cells using lipofectamine 2000 reagent (Life Technologies) per the manufacturer’s instructions.
-
bioRxiv - Genetics 2020Quote: AAG AGC TCT TCA GAA ATG GAT GCC ATG TGT GTC TCC TCT TCC TGA-3’) derived from the intron 10 of PIK3C2B were biotin-labeled using Biotin 3’-End DNA Labeling Kit (Thermo Scientific). Biotin-labeled ssODNs were then annealed with reverse complimentary ssODNs to generate biotin-labeled probes ...
-
bioRxiv - Microbiology 2024Quote: ... and with α-mouse Alexa Fluor555-conjugated secondary antibody (Invitrogen; goat derived). DAPI was used for nuclear staining and to control for remaining T cells in the microscopical analysis ...
-
bioRxiv - Microbiology 2022Quote: ... Secondary antibodies for immunofluorescence were derived from donkey and purchased from Life Technologies: anti-goat Alexafluor 647 ...
-
bioRxiv - Cell Biology 2022Quote: Human-derived derived near-haploid HAP1 cells were cultured in IMDM (GIBCO) supplemented with 12% FCS ...
-
bioRxiv - Molecular Biology 2021Quote: ... derived from pcDNA5 (Invitrogen) and containing the wild type (wt ...
-
bioRxiv - Cancer Biology 2024Quote: ... CNAs derived from Affymetrix SNP 6.0 (SNP6 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1 μg of pUC19-piggyBAC transposase plasmid using Lipofectamine 3000 (Invitrogen) according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... These were co-transfected with piggybac transpose vector using Lipofectamine 3000 (Invitrogen) to the QKO mESC cell line ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1μg pUC19-piggyBac transposase 23 using Lipofectamine 3000 (Thermo Fisher L3000001). Starting around 24h after transfection and lasting at least 10 days ...
-
bioRxiv - Molecular Biology 2021Quote: H5C6 hybridoma-derived antibody was modified with AlexaFluor 647-NHS ester (Thermo Fisher Scientific) at a 1:5 (antibody ...
-
bioRxiv - Pathology 2022Quote: ... The donkey-derived Alexa Fluor-conjugated secondary antibodies included anti-mouse 488 (A21202, Invitrogen); anti-Rat 488 (A21208 ...
-
bioRxiv - Microbiology 2024Quote: ... Secondary antibodies for immunofluorescence microscopy were derived from donkey and purchased from Life Technologies or Abcam ...
-
bioRxiv - Developmental Biology 2020Quote: Adipocytes derived from hPSC-derived MSCs were washed with PBS (Thermo Fisher Scientific) and fixed in 4% PFA in 0.1 M PBS (pH 7.4 ...
-
bioRxiv - Cell Biology 2021Quote: ... H9 derived-cholangiocytes and CF9 derived cholangiocytes were stained with 10μM Fluo4 (Invitrogen) with 0.04% Pluronic F127 (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... trace elements (1%; Fisher Scientific), and fetal bovine serum (5% vol/vol ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNAs were transferred into a piggyBac vector PB-CMV* by LR recombinase (Invitrogen). In this vector ...
-
bioRxiv - Biochemistry 2020Quote: ... were derived from pPICZB (Invitrogen) as described [33,45] ...
-
Vps18 contributes to phagosome membrane integrity in Mycobacterium tuberculosis-infected macrophagesbioRxiv - Microbiology 2023Quote: ... Antibodies: Galectin 3 (Invitrogen MA1-940), Galectin 9 (Abcam ...
-
bioRxiv - Bioengineering 2021Quote: ... 0.1% Trace Elements A (Fisher Scientific), 0.1% Trace Elements B (Fisher Scientific) ...
-
bioRxiv - Bioengineering 2021Quote: ... 0.1% Trace Elements B (Fisher Scientific), and 200 nM Methotrexate (MTX ...
-
bioRxiv - Bioengineering 2021Quote: ... 0.1% Trace Elements A (Fisher Scientific), 0.1% Trace Elements B (Fisher Scientific) ...
-
bioRxiv - Bioengineering 2021Quote: ... 0.1% Trace Elements B (Fisher Scientific), and 200 nM Methotrexate (MTX ...
-
bioRxiv - Microbiology 2021Quote: ... antibodies were raised against a peptide containing an N-terminally derived sequence (ERQTQSSLEDSDDQFGDPR, Thermo Fisher, USA) (1:500 dilution of serum) ...
-
bioRxiv - Immunology 2021Quote: ... for human serum or plasma derived antibodies or a 1:25 dilution of biotin goat anti-rat or anti-mouse IgG antibody (A16088, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... Replicates of hiPSC-derived neurons were harvested at three different timepoints of differentiation (days 1, 3, and 7) with 200 µl Trizol (Invitrogen) per sample and stored at −80 °C until sequencing ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was extracted from hiPSC-derived cortical neurons at DIV8 (Q5, Q6, n=3 each group) using the miRVana miRNA isolation kit (#AM1560, Ambion, Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... Washed samples were incubated for 1h at RT with the secondary antibody (1:200 Alexa Fluor 647 goat derived anti-rabbit antibody, Thermo Fisher Scientific). Then ...
-
bioRxiv - Cell Biology 2020Quote: The following secondary antibodies (all derived from goat, diluted 1:1000) were used (all from Life Technologies): anti Rabbit (Alexa Fluor 405/488/568/647) ...
-
bioRxiv - Neuroscience 2024Quote: ... Control 1 (C1) and 2 (C2) were derived by StemBANCC from an unaffected volunteer and control 3 (C3) was purchased from Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: HDFs derived from the 75-year-old donor were transfected with AMPKα2 siRNA oligonucleotides (5’ ACCGAGCUAUGAAGCAGCUGGAUUU 3’) (Invitrogen, Waltham, MA, USA). Lipofectamine RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the piggyBac transposase were nucleofected in 106 hESCs and plated in Geltrex (Life technologies) coated plates using CM media supplemented FGF2 (20ng/mL ...
-
bioRxiv - Neuroscience 2021Quote: ... iPSC-derived neurons and iPSC-derived astrocytes using the MEM-PER Plus Membrane Protein Extraction Kit (ThermoFisher Scientific), and protein concentrations were determined by bicinchoninic acid (BCA ...
-
bioRxiv - Genomics 2021Quote: ... Each tissue was represented by 2-3 individual replicates that were each derived by pooling tissues from 3-5 mice and FACS sorting cells directly into TRIZOL (Invitrogen, cat. 15596026). In some cases ...
-
bioRxiv - Neuroscience 2022Quote: ... Donkey derived secondary antibodies conjugated with Alexa Fluor-488 or −647 (1:500; Thermo Fisher Scientific; #A-11034) (1:500 ...
-
bioRxiv - Immunology 2023Quote: ... incubated for 2 h at room temperature with the appropriate secondary antibodies (all Donkey-derived from Thermo Fisher or Jackson Immunology using Alexaflours 488 ...
-
bioRxiv - Neuroscience 2021Quote: ... SYN1::RFP) and 0.5 μg of the piggyBac transposase using the Neon Transfection System (Life Technologies), as described [50] ...
-
bioRxiv - Biochemistry 2023Quote: ... 3A and together with the PiggyBac transposase expression plasmid (hyPBase 51) using Lipofectamine 3000 (Thermo Fisher) in 6-well plates seeded with 400,000 HeLa cells the day before ...
-
bioRxiv - Cell Biology 2023Quote: ... coli-derived recombinant human insulin (Gibco, A11382IJ). Contracting cells were noted from day 8 ...
-
bioRxiv - Microbiology 2023Quote: ... All media components were derived from Gibco, Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... using the plasmid derived from pSPORT1 (Invitrogen) (78) ...
-
bioRxiv - Bioengineering 2024Quote: ... Anti-GAPDH (3:1000) monoclonal antibody (mouse) (Invitrogen) was used as a loading control to ensure equal protein loads across all sample lysates ...