Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for Mouse Presenilin Enhancer 2 Homolog C. Elegans PSENEN ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... IgG ELISA Kit (Thermo Fisher Scientific/Invitrogen, 88-50400-86). IgM ELISA Kit (Thermo Fisher Scientific/Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: We used a CORT competitive ELISA kit (ThermoFisher Ref # EIACORT) to analyze serum/plasma corticosterone collected throughout the study ...
-
bioRxiv - Immunology 2023Quote: ... IgE ELISA Kit (Thermo Fisher Scientific/Invitrogen, 88-50460-86). IgG ELISA Kit (Thermo Fisher Scientific/Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... and 25 applying Albumin Human ELISA Kit (Cat.No. EHALB, ThermoFisher) on 24 h conditioned medium according to the manufacturer’s instruction ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Activity was determined using MAPKp38 (Total) InstantOne ELISA kit (Invitrogen) and absorbance was read on a microplate reader.
-
bioRxiv - Cell Biology 2023Quote: Aβ40 and Aβ42 levels were mainly measured by Invitrogen amyloid-β human ELISA Kit (Thermo Fisher, KHB3481 and KHB3441) as per the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were analyzed using Human RANTES ELISA Kit (ThermoFisher, EHRNTS) and IL-1RA Human ELISA Kit (ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: ... IgA ELISA Kit (Thermo Fisher Scientific/Invitrogen, 88-50450-86). 123 eBeadsTM counting beads flow (Thermo Fisher Scientific/Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... IgM ELISA Kit (Thermo Fisher Scientific/Invitrogen, 88-50470-86). IgA ELISA Kit (Thermo Fisher Scientific/Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... IgA ELISA Kit (Thermo Fisher Scientific/Invitrogen, 88-50450-86). 123 eBeadsTM counting beads flow (Thermo Fisher Scientific/Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... IgM ELISA Kit (Thermo Fisher Scientific/Invitrogen, 88-50470-86). IgA ELISA Kit (Thermo Fisher Scientific/Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... Cytokine ELISAs were performed using commercially available kits (Life Technologies), screening supernatant from antigen-restimulated splenocytes.
-
bioRxiv - Neuroscience 2023Quote: The IL-6 Receptor (Soluble) Human ELISA Kit (Invitrogen; BMS214) was used to quantify soluble IL-6Ra expression in cell culture media ...
-
bioRxiv - Neuroscience 2022Quote: ... The resulting lysate was used to quantify the amount of clusterin present in each sample using the Mouse Clusterin ELISA Kit (Thermo Fisher EM18RB) according to manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: The concentrations of IL-1β in tissue extracts of ovaries and livers were determined using an IL-1 beta Pro-form Mouse Uncoated ELISA kit (88-8014-22; Thermo Fisher Scientific) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Mouse lung homogenates were used to determine IgM protein using an IgM uncoated ELISA kit as directed (Invitrogen-ThermoFisher Scientific, Waltham, MA).
-
bioRxiv - Immunology 2022Quote: ... Mouse lung homogenates were used to determine IgM protein using an IgM uncoated ELISA kit as directed (Invitrogen-ThermoFisher Scientific, Waltham, MA).
-
bioRxiv - Immunology 2020Quote: ... The cell supernatant was diluted 10-fold and the TNF-α content was measured with a mouse TNF-α Elisa kit obtained from Invitrogen. The remaining cells were subjected to CCK8 assay to detect cytotoxicity.
-
bioRxiv - Immunology 2024Quote: Individual cytokines in supernatants from cell culture experiments were measured using the species-appropriate ELISA Kits mouse IL-6 (Invitrogen™ 88706488), mouse IL-1beta (Invitrogen™ 88701388) ...
-
bioRxiv - Immunology 2024Quote: IFNγ in supernatants from the whole blood RSA was determined by ELISA according to the manufacturer’s instructions (Human IFNγ Uncoated ELISA kit; Invitrogen). 50μl of supernatant was diluted with 50μl of assay diluent for use in the IFNγ ELISA ...
-
bioRxiv - Molecular Biology 2022Quote: ... elegans (GTCAAGCTTCGGTCTTCATCCCCAAGCCATTCAGGGCCTTTGCCTTTGTTACATTTGCAGATGATCAGATTGCGCAGTCTCTTTGTGGAGAGGACTTGATCATTAAAGGAATCAGCGTTCATATATCCAATGCCGAACCTAAGCACAATAGCAATAGATCAGTTGGCCCTGATTATGGCCTTCCAGCTGGCTACCGTAACCGCAGAGAACGTGATCGACCGGATAGACGACCGATTCAAAATGAAGCACCTCTGCCCATGCCATTCGTCCGCCCACCACAAGATTACTCATACCGTCAGCAAAATTCTCCCCTCGAGAGGAGATACTGGGCACCTGGAGACTCGAGAGGACCAGGATGGCGGGATCCGTC) was ordered in GeneArt gene synthesis services (Thermo Fisher, Waltham, MA, USA). The fragment was digested and inserted into the HindIII and BamHI sites of pmeGFP-C1 (pGFP-F220c).
-
bioRxiv - Genetics 2021Quote: ... overnight at 4°C and then for 2 hours with Dynabeads M-280 Sheep Anti-Mouse IgG (Invitrogen 11201D). After 3 800uL washes in LiCl buffer (100mM Tris HCl pH 7.5 ...
-
bioRxiv - Synthetic Biology 2023Quote: Mitomycin C (MMC) (Fisher Scientific, BP2531-2).
-
bioRxiv - Evolutionary Biology 2022Quote: ... Stained tissues were treated with Image-iT FX Signal Enhancer (Invitrogen) and washed in 5% normal goat serum in PBS + 0.1% Tween-20 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos were treated with Image-iT Signal Enhancer (ThermoFisher Scientific, I36933) for 30 min ...
-
bioRxiv - Microbiology 2019Quote: ... 2.5 μL of GC enhancer (Thermo Fisher Scientific, Carlsbad, California, USA), 2 μL of DNA (1:10 diluted ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were then incubated with Image-iT FX signal enhancer (ThermoFisher) for 30 min at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... samples were blocked with Image-iT™FX signal enhancer (Invitrogen) for at least 30’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... and incubated in Image-iT™ FX Signal Enhancer (Thermo Fisher) for 15 minutes at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... diluted at 1:600 in Pierce™ Immunostain Enhancer solution (Thermofisher) complemented with 0,5% triton X-100 and 0,1% Tween for 5 days at RT under gentle rocking ...
-
bioRxiv - Bioengineering 2023Quote: ... MCF7 cells required additional treatment with BacMam enhancer (Fisher Scientific, USA) to express FUCCI following manufacturer instructions.
-
bioRxiv - Biophysics 2023Quote: ... cells were blocked in Image-iT FX signal enhancer (I36933, Invitrogen) for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... were also incubated with SuperSignal™ Western Blot Enhancer (Thermo Fisher).
-
bioRxiv - Neuroscience 2022Quote: ... Serum TNF and IL-1β concentrations were determined by using a rat TNF alpha Uncoated ELISA and a rat IL-1β ELISA Kit (all from Invitrogen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Enzyme-linked immunosorbent assays (ELISAs) for human IL-8 were performed using the Human IL-8 ELISA Kit (ThermoFisher SCIENTIFIC) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: IL-17a ELISAs were performed using Human IL-17A (homodimer) ELISA Ready-SET-Go!™ Kit (Invitrogen™; eBioscience™), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... and RNA was reverse transcribed using Verso cDNA kit with random hexamers and RT enhancer (Thermo Fisher, Waltham, MA, USA). PCR amplification of conserved coronavirus regions using previously reported primer pairs was used to screen the cDNA [60] ...
-
bioRxiv - Genetics 2021Quote: ... by using PCR stitching to create an enhancer reporter which was sequence verified and purified with a PureLink PCR purification kit (ThermoFisher) for injection ...
-
bioRxiv - Microbiology 2020Quote: ... consisting of lysis enhancer and resuspension buffer at a 1:10 ratio (both from the CellsDirect One-Step RT-qPCR kit; Invitrogen). Next ...
-
bioRxiv - Genetics 2020Quote: ... The section of the membrane with separated 300 - 95 kDa proteins was incubated with primary antibodies against C-terminus of Pol2 described in the previous section at 1:500 – 1:1,000 dilution in diluent provided in SuperSignal Western Blot Enhancer Kit (Thermo Fisher). Section of the membrane with 75-50 kDa proteins was incubated with rat monoclonal antibodies against yeast α-tubulin (sc-53030 ...
-
bioRxiv - Immunology 2020Quote: ... Cytokine concentrations were measured by ELISA or Luminex Multiplex Assay (Invitrogen Mouse 20-plex). To determine host susceptibility to endotoxemia ...
-
bioRxiv - Biochemistry 2023Quote: α-synuclein was quantified in the striatum region of mouse brain utilizing the Enzyme-linked Immunosorbent Assay (ELISA) Kit from Invitrogen (Cat No. KHB0061) following the manufacturer‘s instructions.
-
bioRxiv - Genetics 2021Quote: ... We quantified expression using the IgG4 Human ELISA kit (Invitrogen BMS2095) with IgG4 standards provided in the kit ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... IL-1β and TNFα were analyzed using ELISA kits (Thermo Scientific) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: Murine TNF-α and IL-1β were quantified in cell supernatants using ELISA™ Kit from Invitrogen and human IL-1β using Instant ELISA™ Kit from Invitrogen, following manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: The IL-33 Quantikine ELISA kit was purchased from Applied Biosystems and manufacturer instructions were followed ...
-
bioRxiv - Immunology 2020Quote: IL-13 was measured using an eBioscience ELISA kit (Thermo Scientific) using the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Corticosterone levels were determined using the Corticosterone Competitive ELISA kit (Invitrogen) and normalized to the weights of colon pieces measured before the assay.
-
bioRxiv - Synthetic Biology 2020Quote: ... and IFN-β were detected using an ELISA kit (Thermo Scientific) as previously described (26) ...
-
bioRxiv - Bioengineering 2020Quote: ... An IgG4 Human ELISA Kit (Cat # BMS2095, Thermo Fisher, Waltham, MA) was purchased to verify the antibody secretion titer according to the manufacturers instructions.