Labshake search
Citations for Thermo Fisher :
601 - 650 of 10000+ citations for Mouse Mesoderm Specific Transcript Protein MEST ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... Qubit protein assay kit (Invitrogen) was used to obtain protein concentration ...
-
bioRxiv - Immunology 2019Quote: The concentration of sPD-1 and sTim-3 was measured in thawed plasma samples by enzyme linked immunosorbent assay (ELISA) using Human PD-1 (PDCD1) ELISA kit [EHPDCD1] (Thermo Fisher Scientific, Waltham, MA USA) and Quantikine ELISA Human TIM-3 Immunoassay kit [DTIM30] (R&D Systems ...
-
bioRxiv - Immunology 2023Quote: ... ELISAs were developed using 1-Step Ultra TMB ELISA substrate (Life Technologies), with the reaction being terminated with 0.5M H2SO4 ...
-
bioRxiv - Immunology 2023Quote: ... ELISAs were developed using 1-Step-Ultra TMB ELISA substrate (Life Technologies), terminating the reaction with 0.5 M H2SO4 ...
-
bioRxiv - Neuroscience 2023Quote: ... The specific probes (ThermoFisher) that have been used are as follow ...
-
bioRxiv - Biochemistry 2020Quote: DNA and RNA were quantified using DNA/RNA specific fluorescent detection kits (Qubit, Invitrogen). Total protein was measured using BCA detection kit (Pierce).
-
bioRxiv - Microbiology 2019Quote: Specific miRs were reverse-transcribed using the Taqman MicroRNA reverse transcription kit (Applied Biosystems), according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... followed by non-specific degradation of contaminant DNA using the Turbo DNAse kit (Ambion). Following extraction ...
-
bioRxiv - Microbiology 2023Quote: ROS detection was done using a specific detection kit (Life Technologies, Carlsbad, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: MaxiSorp ELISA plates (Nunc) were coated with whole-cell suspensions at OD 0.1 of N ...
-
bioRxiv - Immunology 2019Quote: ... 96 ELISA plate (Nunc MaxiSorp™ flat-bottom ...
-
bioRxiv - Immunology 2019Quote: ... 96 ELISA plates (Nunc MaxiSorp™ flat-bottom ...
-
bioRxiv - Immunology 2022Quote: MaxiSorp ELISA plates (Invitrogen), were coated with purified recombinant SARS-COV-2 RBD domain (BEI ...
-
bioRxiv - Biochemistry 2019Quote: ... The ELISA plates (Nunc-Immuno Plate ...
-
bioRxiv - Cell Biology 2021Quote: ... the ELISA plate (Nunc-Immuno™ plates ...
-
bioRxiv - Cancer Biology 2022Quote: ... ELISA plates (Thermo Fisher) were coated overnight at 4°C with 1 μg/ml anti-CD19 MAb FMC63 (Novus ...
-
bioRxiv - Microbiology 2021Quote: ... MaxiSORP ELISA plates (Nunc) were pre-coated with spike protein (2 μg/mL ...
-
bioRxiv - Immunology 2020Quote: ... MaxiSorp ELISA plates (Nunc) were coated with 2 μg/ml of SARS-CoV-2 Spike overlapping peptide pools corresponding to whole S1 or S2 proteins (JPT ...
-
bioRxiv - Immunology 2021Quote: ... Maxisorp ELISA plates (Nunc) were coated with 50ng/well of recombinant S1 spike protein of SARS-CoV-2 (Acro ...
-
bioRxiv - Immunology 2021Quote: ... and the ELISA (Invitrogen) was carried following the manufacturer protocol.
-
bioRxiv - Immunology 2020Quote: ... and corticosteroids ELISA (Thermofisher) kit following manufacturers’ instruction ...
-
bioRxiv - Immunology 2020Quote: ... MaxiSORP ELISA plates (Nunc) were pre-coated with recombinant luciferase (0.4μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... Maxisorp ELISA plates (Nunc) were coated overnight with anti-IgG1 or anti-IgG4 (2 µg/ml clones MH161-1 ...
-
bioRxiv - Microbiology 2022Quote: ... Immulon IV ELISA (Nunc) plates were coated with 10 μg/mL of fecal antigen in Coat Buffer (0.05M Na2CO3 ...
-
bioRxiv - Immunology 2022Quote: ... ELISA plates (Nunc Maxisorp) were coated with NP20-BSA (Biosearch Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... ELISA plates (MaxiSorp, ThermoFisher) were coated with respective antigens at concentration of 0.1μg/well ...
-
bioRxiv - Plant Biology 2023Quote: ... Beads that were made specific for DEAP2 by attaching the antibody to Protein G-coupled beads (Dynabeads, ThermoFisher) according to protocol ...
-
bioRxiv - Microbiology 2024Quote: Total RNA and RNA enriched upon specific protein immunoprecipitation (RIP) were extracted using TriReagent (Invitrogen, Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: Total RNA and RNA enriched upon specific protein immunoprecipitation (RIP) were extracted using TriReagent (Invitrogen, Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein concentrations were measured using a protein assay kit (Pierce™ BCA Protein Assay Kit, #23225, ThermoFisher Scientific, Cheshire, UK). Protein samples were resolved through 10% SDS-polyacrylamide gel and transferred to nitrocellulose membrane ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentrations were measured using the BCA Protein Assay Kit (Pierce™ BCA Protein Assay kit, Thermo Fisher Scientific, 23225) and a Tecan Infinite M200 Plate Reader.
-
bioRxiv - Neuroscience 2022Quote: ... Total protein in brain tissue was determined using a protein assay kit (Pierce™ BCA Protein Assay Kit; ThermoFisher, 23225) following the manufacturer’s protocol.
-
bioRxiv - Immunology 2023Quote: ... Total protein quantification was determined using Pierce™ BCA Protein Assay Kit (Thermo Scientific Pierce™ BCA Protein Assay Kit) and samples were stored at -80°C until use.
-
bioRxiv - Cancer Biology 2024Quote: ... Protein concentrations were measured using the BCA Protein Assay Kit (Pierce™ BCA Protein Assay kit, Thermo Fisher Scientific, 23225) and a Tecan Infinite M200 Plate Reader ...
-
bioRxiv - Developmental Biology 2022Quote: ... a 1:4,000,000 dilution of ERCC spike-in transcripts (Life Technologies, #4456740) was added to each sample ...
-
bioRxiv - Genomics 2019Quote: ... Transcripts were amplified in a 7300 real-time PCR system (Applied Biosystems) using Power SybrGreen detection (Life Technologies) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Differential Expression analysis was performed using the Transcript Analysis Console 4.0 (ThermoFisher).
-
bioRxiv - Cancer Biology 2020Quote: ... transcript levels were measured using SYBR Green qPCR (Applied Biosystems, cat # 4367659). Relative RNA levels in whole-cell lysates were determined by normalizing expression levels of the target genes to expression levels of GAPDH ...
-
bioRxiv - Cancer Biology 2021Quote: ... Relative transcript abundance was obtained using Power SYBR Green Master Mix (ThermoFisher) using the QuantStudio 6 Flex Real-Time PCR System using primers for OAS1 (GATGAGCTTGACATAGATTTGGG and GGTGGAGTTCGATGTGCTG ...
-
bioRxiv - Developmental Biology 2020Quote: ... qRT-PCR was performed for each transcript using SYBR Green (Life Technologies) as the detection method.
-
bioRxiv - Cell Biology 2022Quote: ... mRNA transcripts were reverse transcribed using Maxima H-RT (Thermo Fisher EPO0753) in a template-switching-based RACE reaction ...
-
bioRxiv - Immunology 2023Quote: ... mRNA transcripts were reverse transcribed using Maxima H-RT (Thermo Fisher EPO0753) in a templateswitching-based RACE reaction ...
-
bioRxiv - Microbiology 2023Quote: ... with 1.5 µg of the run-off RNA transcripts using Lipofectamine2000 (Invitrogen) transfection reagent according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Vero cells were transfected with obtained RNA transcripts using Lipofectamine 2000 (Invitrogen) reagent ...
-
bioRxiv - Cell Biology 2023Quote: ... for host transcripts or TaqMan™ Fast Advanced Master Mix (Applied Biosystems) for viral transcripts ...
-
bioRxiv - Molecular Biology 2024Quote: ... A 530 nt gap transcript was produced using reagents from Thermo Scientific following the protocol for conventional in vitro transcription ...
-
bioRxiv - Cancer Biology 2020Quote: ... and TNF-α levels were measured using ELISA kits (ThermoFisher Scientific, Waltham, MA, USA), with sensitivities of <3 pg/mL ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The ELISA was performed using Human IL-1ẞ high sensitivity kit sold by Invitrogen. The sample for our ELISA consisted of cell culture media (referred to as sample hereafter ...
-
bioRxiv - Molecular Biology 2022Quote: ... corrected for the amount of total ERK using ERK1/2 (Total) ELISA Kit (Invitrogen) to measure ERK levels.
-
bioRxiv - Neuroscience 2022Quote: ... CORT was measured using the Corticosterone Competitive ELISA kit (Thermo Fisher, #EIACORT, Waltham, MA) following manufacturer’s instructions for small volume blood plasma ...