Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for Mouse Anti Tick borne Encephalitis Virus NS1 M837 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-RetP1 (ThermoFisher) (1:100) ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse anti-Prdx5 (Invitrogen), rabbit anti-hnRNPK (CST) ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-mouse (Thermo Scientific) or by HRP-conjugated secondaries (Bio-Rad) ...
-
bioRxiv - Immunology 2022Quote: ... anti-Mouse IgG (Invitrogen) was used as isotype control ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-mouse (A11017; Invitrogen), Alexa Fluor 488 goat ...
-
bioRxiv - Plant Biology 2020Quote: ... anti-mouse Alexa488 (Invitrogen) and anti-rabbit CY3 (Dianova)-conjugated secondary antibodies were diluted 1:600 ...
-
bioRxiv - Immunology 2020Quote: ... then anti-mouse (Invitrogen) or anti-human (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-mouse IgG2a (ThermoFisher)] diluted 1:1000 for 1hr at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... mouse anti-GAPDH (Invitrogen)] ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-H3K4me3 (Invitrogen). Secondary antibodies were purchased from Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-GFP (Invitrogen) 1/50 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Vesicular stomatitis virus glycoprotein-pseudotyped virus was produced by co-transfecting 293T cells using Lipofectamine 2000 (Invitrogen) with an shRNA transducing vector and 2 packaging vectors ...
-
bioRxiv - Microbiology 2023Quote: ... tissue sections were incubated with the primary antibody (rabbit polyclonal anti-Influenza A virus NP [ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... PA (1:250), PB2 (1:250), NS1 (1:250, PA5-32243 and NS2 (1:250, PA5-32234) were all purchased from Thermo Scientific, Rockford ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-Rabbit and anti-mouse from Thermofisher) and a ChemiDoc MP Imaging System with Image LabTM-Touch Software Version 2.2.0.08 ...
-
bioRxiv - Microbiology 2023Quote: ... generated by Knut Falk in the late 1990s) or mouse IgG2a targeting influenza virus NP (clone D67J, Thermo Fisher Scientific) (both ...
-
bioRxiv - Systems Biology 2024Quote: ... Incubations were performed with mouse anti-FLAG or mouse anti-V5 (ThermoFisher Scientific), and secondary anti-mouse IgG coupled with alkaline phosphatase (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... the tissues were singularly included in Tissue-Tek®O.C.T.™ Compound (Sakura) and 25 tick sections were cut on Superfrost Plus adhesion slides (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2022Quote: PCR experiments amplifying regions of VLTs from tick cDNA and genomic DNA were run using Platinum Superfi II Green PCR master mix (Thermo Fisher Scientific). We loaded 5uL of product onto 0.7% agarose gels and ran them at 160V for 2 hours before imaging ...
-
bioRxiv - Neuroscience 2023Quote: ... Coronal sections 50 um thick were immunostained for tyrosine hydroxylase (primary: mouse anti-TH, Millipore #MAB318; secondary: goat anti-mouse 647, Invitrogen #A-21236 or goat anti-mouse 405, Invitrogen #A-31553), tryptophan hydroxylase 2 (primary ...
-
bioRxiv - Microbiology 2019Quote: ... The viral N-protein was labeled using a primary anti-Tula virus antibody(12) and a secondary anti-rabbit FITC conjugate (Invitrogen, USA). The viral Gc protein was stained using a mouse monoclonal antibody (#H1808-60B ...
-
bioRxiv - Immunology 2021Quote: ... Virus was titrated by adding serial dilutions of virus supernatant (8 replicates) on VeroE6 cells in DMEM (Gibco) containing 2% FBS ...
-
bioRxiv - Microbiology 2023Quote: ... Mice were anesthetized with ketamine-xylazine and infected intranasally with 5,000 PFU of the non-recombinant virus or 1,000 PFU of the recombinant virus in 50 μl of Dulbecco’s Modified Eagle Medium (DMEM) (Gibco). For antibody treatment ...
-
bioRxiv - Immunology 2024Quote: ... Infection was initiated by adding 100 µl of virus inoculum containing 100.000 PFU (MOI ∼0.5-1) in virus absorption medium (Gibco OptiPro Serum free medium + 1:100 Glutamax + 10 mM HEPES ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated with appropriate secondary antibodies (488 anti-chicken, 546 anti-mouse, 647 anti-guinea pig, 647 anti-rabbit, 647 anti-mouse, Alexa Fluor, Life Technologies)
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-V5 mouse (Invitrogen, # R960-25, 1/1000), mouse anti-FLAG (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... PE-Cy5-conjugated mouse anti-mouse CD45.1 (A20; Thermofisher), PE-Cy5 or PE-CF594-conjugated rat anti-mouse CD45R/B220 (RA3-6B2 ...
-
Histone deacetylase inhibitors butyrate and bufexamac inhibit de novo HIV-1 infection in CD4 T-cellsbioRxiv - Microbiology 2020Quote: ... Pelleted virus was resolved in PBS (Gibco) and stored at −80°C until further usage ...
-
bioRxiv - Immunology 2019Quote: ... murine leukemia virus reverse transcriptase (RT; Invitrogen), and random hexamers (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2021Quote: ... Fibroblasts were reprogrammed using Sendai virus (Invitrogen) in feeder-free conditions on Matrigel (Corning ...
-
bioRxiv - Cell Biology 2023Quote: ... and EmGFP reporter Sendai Virus (A16519, Invitrogen) were part of the Cytotune -iPS 2.0 Sendai Reprogramming kit and EmGFP Sendai Fluorescence Reporter kit ...
-
bioRxiv - Immunology 2024Quote: ... in virus growth medium (1X MEM [Gibco 11095080] ...
-
bioRxiv - Cell Biology 2019Quote: ... Anti-rabbit or -mouse Alexa 488 and anti-mouse or -rabbit Alexa 568 (Invitrogen) secondary antibodies were used at a 1:250 dilution ...
-
bioRxiv - Immunology 2023Quote: ... Anti-mouse IL-10 and anti-mouse IL-13 antibodies were purchased from Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1μl of sample was mixed in 20μl final of SoFast-Green reaction mix containing 10nM of forward (CCGTCTTAAGTTTGATTTT) and reverse (AGAGGTGGACCAACTCGGTA) primers for MVMp NS1 gene amplification using the StepOnePlus real-time PCR system (Thermo Fisher Scientific). Primers targeting the 18S gene were used for normalization (forward ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-©tubulin (mouse monoclonal, MilliporeSigma T6557, 1:200) and mouse anti-ZO-1 (Life Technologies, 1:300). Rabbit anti-Pard3 (rabbit polyclonal ...
-
bioRxiv - Microbiology 2020Quote: ... and mouse anti-Actin (Invitrogen) at 1:3000 in 2% Bovine Serum Albumin (BSA) ...
-
bioRxiv - Bioengineering 2020Quote: ... mouse anti-PGK1 monoclonal (Invitrogen)) at 4°C overnight ...
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-GAPDH (ThermoFisher AM4300), rabbit anti-Sra-1 (1/1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-V5 (Thermo Fisher Scientific Cat# R960-25 ...
-
bioRxiv - Cell Biology 2020Quote: ... goat anti-mouse 680 (Invitrogen), goat anti-rabbit 800 (Invitrogen).
-
bioRxiv - Microbiology 2021Quote: ... anti-mouse Alexa488 antibody (Invitrogen), and Hoechst 33258 (Santa Cruz Biotechnology ...
-
bioRxiv - Genomics 2022Quote: ... goat anti-mouse (Invitrogen #G21040), goat anti-rabbit (Invitrogen #G21234).
-
bioRxiv - Molecular Biology 2020Quote: ... mouse monoclonal anti-V5 (Invitrogen R960-25 ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-mouse Alexa 594 (Invitrogen), at 1:200 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse-anti V5 (Invitrogen, R96025). Donkey anti-rabbit Alexa 568 (1:500 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-GAPDH (Invitrogen, AM4300), mouse anti-β-actin (Proteintech ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-mouse-HRP (1;10,000; Invitrogen), and anti-chicken-HRP (1:20,000 ...
-
bioRxiv - Genetics 2020Quote: ... donkey anti-mouse (Invitrogen A21203), rabbit anti-guinea pig (ThermoFisher PA1-28595).
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-Golgin 97 (ThermoFisher), 1μg/ml ...