Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for Mouse Anti Canine Distemper Virus Surface Envelope Antibody 5 4 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Cells were then washed with PBS with 0.03% NaN3 for 15 mins RT × 4 and incubated in secondary antibodies at 1:1000 dilution (goat anti-mouse 488, Thermo Fisher Scientific# A-28175 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pH 7.0) and 2 µg anti-5-methylcytosine (5-mC) antibody (Thermo Fisher, 33D3), and incubated at 4°C overnight with rotation ...
-
bioRxiv - Biochemistry 2023Quote: ... and secondary antibody anti-IgG (anti-mouse or anti-rabbit, Invitrogen #31430 and #31460) coupled to Horse Radish Peroxidase.
-
bioRxiv - Immunology 2020Quote: ... goat Anti-Mouse IgG2a cross absorbed HRP antibody, Southern biotech, 1083-05; Goat anti-Mouse IgG1 cross absorbed HRP antibody, Thermo Fisher, A10551). The IgG2a/IgG1 ratio was calculated by dividing the absorbance read in the well incubated with the IgG2a secondary antibody divided the absorbance for the same sample incubated with the IgG1 antibody.
-
bioRxiv - Developmental Biology 2021Quote: ... Immunolabeling with performed with mouse anti-B23 primary antibody (1:300; 2h) then detected with Alexa 488 donkey anti-mouse antibody (Invitrogen; 1:500; 1h), then further fixed with 4% paraformaldehyde in DEPC-PBS ...
-
bioRxiv - Microbiology 2021Quote: ... incubated with corresponding secondary antibodies (Alexa488- and 594-conjugated anti-rabbit IgG, anti-mouse IgG, or anti-mouse IgG1 (1:500; Invitrogen)) in blocking buffer for 2 hours at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... incubated with corresponding secondary antibodies (Alexa 488-/ 594-conjugated anti-rabbit IgG, anti-mouse IgG, or anti-mouse IgG1 (1:500; Invitrogen)) in blocking buffer for 2 hours at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... or (4) anti-mouse coupled to Alexa Fluor555 (1:1000, Invitrogen, A21422), Phalloidin-coupled to Alexa Fluor 488 (1:1000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Supplementary Table 4) on Sheep Anti-Mouse IgG Dynabeads M-280 (ThermoFisher) overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... PE rat anti mouse IgA (mA-6E1, 4 μg/ml; Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... followed by 4 ng μL−1 goat-anti-mouse-AF488 (Thermo Scientific). Cells were resuspended in 1 mL FACSFlow buffer (BD Biosciences ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were incubated with secondary antibodies diluted 1:1000 in 5% BSA in PBST (anti-mouse Alexa Fluor 555, CST 4409S; anti-mouse Alexa Fluor 647, Invitrogen, A-21235 ...
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Cell Biology 2020Quote: ... The antibodies used were: mouse IgG2a anti-V5 tag monoclonal antibody (Thermo Fisher Scientific Cat# R960-25 ...
-
bioRxiv - Genetics 2019Quote: Antibodies used in this study: mouse anti-V5 antibody (R960-25, Thermo Fisher) used at a 1:2,000 dilution ...
-
bioRxiv - Genetics 2019Quote: ... as primary antibody (1:400) and Alexa 488-conjunated anti-mouse antibodies (Invitrogen) as secondary antibody ...
-
bioRxiv - Cancer Biology 2023Quote: ... primary antibody and Alexa Fluor-647 anti-mouse secondary antibody (Thermo Fisher Scientific) following 24h of treatment with anti-CD3 and anti-CD28 antibodies as described in Primary T cell nucleofection and treatments section ...
-
bioRxiv - Cell Biology 2024Quote: ... Secondary antibodies were anti-mouse Alexa Fluor 488-conjugated secondary antibody (Invitrogen A11001), anti-mouse Rhodamine Red-X (RRX)-conjugated secondary antibody (Jackson ImmunoResearch ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies: Claudin-5 (mouse, clone 4C3C2, ThermoFisher cat# 35-2500, 1:100), Iba1 (goat polyclonal ...
-
bioRxiv - Biochemistry 2019Quote: Antibodies and antibody Fabs were produced as described previously.57 BG505 N332 SOSIP gp140 envelopes were expressed as previously described with minor modifications.58 Envelope production was performed with Freestyle293 cells (Invitrogen). On the day of transfection ...
-
bioRxiv - Immunology 2022Quote: ... and suspended in Fc Block for 5 min at RT prior to staining with a surface stain of following antibodies: CD3 (Invitrogen, 45-0031-82)/CD4 (BD ...
-
bioRxiv - Immunology 2021Quote: ... Triton X-100 with 5 % normal-goat-serum and unconjugated F(ab′)2 goat anti-mouse IgG (H+L) antibody (1:500, Thermo Scientific), at 4 °C for 2 h ...
-
bioRxiv - Microbiology 2020Quote: ... Devices were washed twice with PBS followed by one rinse with 3% NGS plus 0.1% Tween-20 for 5 min each with rocking and secondary antibodies Alexa Fluor 488 goat anti-mouse IgG (Thermo Fisher) and Alexa Fluor 555 goat anti-rabbit IgG (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2020Quote: ... Single cells were stained with anti-mouse fluorochrome-conjugated antibodies: CD4 PE-eFluor 610 (1:400, RM4-5, Thermo Fisher Scientific), CD8a PE (1:200 ...
-
bioRxiv - Biochemistry 2021Quote: ... and a goat anti-mouse antibody conjugated with Alexa Fluor 488 (Life Technologies; 2 μg/ml in ND96 with 5% BSA) was applied for 1h at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... previously incubated or not for 30 min at room temperature with 5-50 ng/μL anti-mouse tau monoclonal antibody T46 (Thermo Scientific) or anti-human tau monoclonal antibody SP70 (Rockland ...
-
bioRxiv - Neuroscience 2022Quote: ... Neurons were then permeabilized with 0.1% Triton X-100/5% normal goat serum/PBS and incubated with anti-mouse Alexa-546 secondary antibody (1:1000; Thermo Scientific) for 2 hr ...
-
bioRxiv - Bioengineering 2020Quote: ... Membrane was blocked with 5 % skim milk and antibody labeling used a primary mouse monoclonal anti-6xHis (Thermo Fisher, #MA1-21315) and a secondary rabbit anti-mouse IgG with HRP (Abcam ...
-
bioRxiv - Genomics 2019Quote: ... Samples were then washed three times in PBS for 5 minutes and incubated in secondary antibody (Alexa Fluor 488 goat anti-mouse, Invitrogen; R37120) for 30 minutes at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were washed with PBS and then incubated in PBS containing 5 % normal goat serum with fluorescent conjugated secondary antibodies (Alexa Fluor 555-conjugated goat anti-mouse IgG, 1:500, Thermo Fisher, A21422 ...
-
bioRxiv - Neuroscience 2024Quote: ... brains were then washed four times in 0.05% PBS-T and then incubated with 5% NGS and secondary antibody (1:400 Alexa 594 goat anti-mouse IgG, Invitrogen A11032) in 0.5% PBS-T for 2 days at 4 °C with nutation ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were then washed and incubated with the secondary antibody dilution (Horse anti-mouse, HRP-ligated, PI 2000, 1:5000 in 5%dry milk, Thermo Fisher) for 1 hour at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... secondary antibodies (Alexa Fluor, Cy3-or Cy5-conjugated anti-mouse and anti-rabbit secondary antibodies, Life Technologies and Jackson Immunoresearch Laboratories ...
-
bioRxiv - Neuroscience 2021Quote: ... Secondary antibodies for immunoblotting included DyLight800-conjugated goat anti-mouse and anti-rabbit antibodies (Thermo Fisher Scientific) as well as donkey anti-guinea pig IRDye 680 and anti-goat AlexaFluor 680 and IRdye800 conjugates (LI-COR Biosciences ...
-
bioRxiv - Cell Biology 2019Quote: ... Horseradish peroxidase-conjugated secondary antibodies and anti-rabbit and anti-mouse antibodies were acquired from Molecular Probes. Alexa Fluor 488 Rabbit ...
-
bioRxiv - Microbiology 2019Quote: ... Secondary antibodies used were Alexafluor-594-coupled anti-rabbit and Alexafluor-647-coupled anti-mouse antibodies (Invitrogen).
-
bioRxiv - Microbiology 2019Quote: ... Anti-NS1 antibody binding was detected by a biotinylated goat anti-mouse IgG secondary antibody solution (ThermoFisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... Antibody binding was identified by incubation with goat anti-rabbit or anti-mouse secondary antibodies (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Anti-mouse ZAKa antibody (proteintech, #14945-1-AP) and anti-human ZAKa antibody were from Thermo Fisher Scientific (A301-993A) ...
-
bioRxiv - Immunology 2023Quote: ... Antibodies used were: anti-CD4 APC-Alexa647 (RM4-5, ThermoFisher), anti-CD8 BUV805 (BD 53-6.7 ...
-
bioRxiv - Pathology 2024Quote: ... HT7 was the only anti-mouse antibody used and a mouse-on-mouse blocking agent (Invitrogen: R37621) was applied for 30 minutes post protein block washes to reduce noise from secondary antibody binding and an additional three 5-minute washes were added before primary antibody incubation ...
-
bioRxiv - Immunology 2019Quote: ... lung tissues were incubated with primary antibodies diluted in PBS with 0.3% TritonX-100 on a rocker at 4° C overnight. Primary antibodies used (Fig. 5) were: rat anti-E-cadherin (E-Cad, 131900, Invitrogen; 1:1000), goat anti-CCSP (1:2,500 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The membrane was washed 5 times 5 min in TBS-T prior to overnight incubation at 4°C with 1° anti-Flag antibody (1:500, ThermoFisher, PA1-984B). The next morning ...
-
bioRxiv - Physiology 2023Quote: ... A mouse anti-mouse antibody conjugated with Alexa Fluor 647 was used (Invitrogen A21058). 4′,6′-Diamidino-2-phenylindole staining was used to counterstain cellular nuclei ...
-
bioRxiv - Cancer Biology 2023Quote: ... Anti-CD4 (RM4-5) and anti-NKp46 (PA5-102860) antibodies were from ThermoFisher. Anti-CD68 and anti-DC-SIGN/CD209 antibodies were from GeneTex ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primary (anti-flag mouse 1:200, Cell Signalling) and secondary antibody (anti-mouse Alexa 488 1:500, Thermofisher) were diluted in blocking buffer solution and incubated overnight at 4°C or 1 hour at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... samples were incubated with secondary anti-mouse antibody conjugated to HRP (goat anti-mouse-HRP, 32430; ThermoFisher Scientific) at 1:20,000 in 5% milk/1xTBST for 1 hour ...
-
bioRxiv - Cancer Biology 2024Quote: ... HEK293T was co-transfected with lentiviral expression constructs (12 µg), viral packaging plasmid (psPAX2, 8 µg), and viral envelope plasmid (pMD2.G, 4 µg) using Lipofectamine 2000 (Invitrogen) following manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2024Quote: ... shRNA plasmids were cotransfected with the packaging and envelope plasmids using Lipofectamine 3000 at a ratio of 4:3:1 (#L3000001, Thermofisher) into LentiX cells ...
-
bioRxiv - Immunology 2024Quote: ... using: anti-Keratin-5 (Chicken anti-mouse; polyclonal; dilution 1:500 in blocking solution; Invitrogen); anti-Keratin-8 (Guinea Pig anti-mouse ...