Labshake search
Citations for Thermo Fisher :
1 - 50 of 8327 citations for L Asparagine H2O 13C4; D3; 15N2 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... L-lysine-13C6-15N2 (Gibco, Cat# 88209), L-arginine-13C6-15N4 (Gibco ...
-
bioRxiv - Bioengineering 2021Quote: ... and non-essential amino acids (10 mM, glycine, L-alanine, L-asparagine, L-aspartic acid, L-glutamic acid, L-proline, L-serine; Gibco). The pre-incubated viruses were then applied to Vero-E6 cell monolayers ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15N2 L-lysine-2 HCl (Lys-8) (Thermo Fisher Scientific). To avoid contamination of light amino acids ...
-
bioRxiv - Microbiology 2022Quote: ... or 13C615N4 L-Arginine HCl/13C6 15N2 L-Lysine-2HCl (Thermo Fisher 89990 and 88209). The parasites were harvested ...
-
bioRxiv - Cell Biology 2023Quote: ... 15N2 (Thermo Fisher Scientific). The cells were grown in the heavy medium for 6 passages until the incorporation of heavy amino acids was at least 95% ...
-
bioRxiv - Cell Biology 2023Quote: ... (Lys4/Arg6)] or Heavy [L-Lysine 2HCl (13C6, 15N2) / L-Arginine HCl (13C6, 15N4) (Lys8/Arg10)] isotopes of lysine and arginine (Thermo Scientific).
-
bioRxiv - Cell Biology 2024Quote: ... and NEAT1-KO AC16 cells were labeled with heavy [l-lysine 2HCl (13C6, 15N2)/l-arginine HCl (13C6, 15N4) (Lys8/Arg10)] isotopes of lysine and arginine (Thermo Scientific). All labeled cells were seeded on a P60 dish ...
-
bioRxiv - Synthetic Biology 2022Quote: ... we used CF-TXTL reaction solutions with 20 amino acid mixtures containing stable isotope-labeled (heavy) L-arginine (13C6, 15N4) and L-lysine (13C6, 15N2) (Thermo Fisher Scientific) instead of unlabeled (light ...
-
bioRxiv - Synthetic Biology 2020Quote: ... we used 20 amino acids that contained 2 mM of 13C6 15N2 L-lysine (Thermo Fisher Scientific) and 13C6 15N4 L-arginine (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... containing either light Arg/Lys or heavy isotope-labeled Arg (13C6 15N4 L-arginine)/Lys (13C6 15N2 L-lysine) (Thermo Fisher Scientific, respectively) at least six doubling times ...
-
bioRxiv - Microbiology 2022Quote: ... Monoclonal anti-stx1 antibody (13C4, Invitrogen, Thermo Fisher Scientific, Waltham, MA) was incubated with 1:20 dilutions of the bacterial supernatants in cell culture media at an antibody ratio of 1:50 for two hours at 37°C with shaking at 100 rpm ...
-
bioRxiv - Microbiology 2022Quote: ... Monoclonal anti-stx1 antibody (13C4, Invitrogen, Thermo Fisher Scientific, Waltham, MA) was incubated with 1:20 dilutions of the bacterial supernatants in cell culture media at an antibody ratio of 1:50 for two hours at 37°C with shaking at 100 rpm ...
-
bioRxiv - Biophysics 2022Quote: ... 0.27 mM L-asparagine, 14 μM folic acid, 1x Corning Penicillin/Streptomycin (100 IU, 0.1 mg/mL respectively) (Fisher Scientific), 50 μM β-mercaptoethanol.
-
bioRxiv - Cell Biology 2020Quote: ... The mouse macrophage cell line RAW264.7 clone D3 was cultured in DMEM containing L-glutamine (Life Technologies), 10% heat-inactivated FBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1 µl of 100 µM bottom splint (IDT) diluted in 7 µl nuclease free H2O (DNase/RNase-Free Distilled H2O, Thermo Fisher Scientific #10977-049). The reaction was annealed at 95 °C for 1m following 20 s at 95 °C and decreasing temperature by 1 °C every cycle ...
-
bioRxiv - Immunology 2020Quote: ... and 105.8 mg/mL L-Arginine U-13C6,U-15N2 R10 (CKGAS, #CNLM-539-H-0.25)) prepared in RPMI SILAC media (Thermo Scientific, #88365) supplemented with 10% dialyzed FBS (HyClone ...
-
bioRxiv - Immunology 2021Quote: ... growth medium including phosphate buffer (5.4 g/l Na2HPO4, 8.6 g/l NaH2PO4·H2O) and 1X Penicillin-Streptomycin (P/S) (Life Technologies 15140122) to avoid bacterial contamination ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 μM asparagine and 100 μg/ml Penicillin-Streptomycin (Invitrogen 15140122), 25 μg/mL Amphoterecin B (Sigma-Aldrich A9528) ...
-
bioRxiv - Molecular Biology 2021Quote: Chemical competent BL21(D3) cells (Invitrogen) were transformed with selected pPE2-Fab plasmids and grown on LBagar/Kanamycin/1% glucose plates ...
-
bioRxiv - Immunology 2021Quote: ... in 19 L of H2O from a Barnstead Nanopure Water system (Thermo Scientific, Waltham, MA). After incubation with SARS-CoV-2 Spike protein ...
-
bioRxiv - Cell Biology 2024Quote: ... for HCMEC/D3 or TrypLETM (12563011, ThermoFisher) for HBMVECs and iCE-BECs ...
-
bioRxiv - Molecular Biology 2024Quote: ... H2O or DEPC-treated H2O (Thermo Fisher Scientific, Extended Data Fig. 4b), and the concentration was measured using a Nanodrop™ 2000 UV/Vis spectrophotometer (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2021Quote: ... DTT and H2O (Invitrogen) and RNA was converted into cDNA (SuperScript III Reverse Transcriptase ...
-
bioRxiv - Immunology 2021Quote: ... DTT and H2O (Invitrogen) and RNA was converted into cDNA (SuperScript III Reverse Transcriptase ...
-
bioRxiv - Immunology 2023Quote: ... DTT and H2O (Invitrogen) and RNA was converted into cDNA (SuperScript III Reverse Transcriptase ...
-
bioRxiv - Genomics 2024Quote: Cells were washed once in 200 µL of Wash Buffer (WB) (47.5 mL RNAse-free H2O, 1 mL 1 M HEPES pH 7.5 (Invitrogen), 1.5 mL 5 M NaCl ...
-
bioRxiv - Cell Biology 2022Quote: ... 8.8 μl DEPC H2O (Ambion) and 1 μl of cDNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... and nuclease-free H2O (Ambion) to make up a volume of 25 μl ...
-
bioRxiv - Cancer Biology 2020Quote: ... and nuclease-free H2O (Ambion) to make up a volume of 25 μl ...
-
bioRxiv - Genetics 2024Quote: ... Purified PCR products were eluted in 25 µl sterile H2O and quantified using a dsDNA broad range assay kit on a Qubit fluorometer 3.0 (both Invitrogen). Sequencing libraries were constructed following ONT’s ’Amplicon barcoding with Native Barcoding’ protocol (version ...
-
bioRxiv - Biochemistry 2024Quote: ... Alkaline hydrolysis sequence ladders were prepared by adding 1 μL of labeled RNA to 4 µL H2O and 10 µL of Alkaline Hydrolysis buffer (50 mM sodium carbonate pH 9.2, 1 mM EDTA) (Ambion). 10 µL of the mix was removed and the remaining 5 µL was incubated at 95 °C for 15 minutes before transferring to ice ...
-
bioRxiv - Cell Biology 2024Quote: cyclin D3 (1:1000, Thermo Fisher Scientific MA5-12717)
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.6 µl nuclease free H2O (DNase/RNase-Free Distilled H2O, Thermo Fisher Scientific #10977-049). cDNA synthesis and template switching were performed for 10 min at 57 °C and 120min at 42 °C ...
-
bioRxiv - Biophysics 2021Quote: ... made of 5:1:1 ratio of H2O : H2O2 (50 wt. % in H2O, stabilized, Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2.75 µl nuclease free H2O (DNase/RNase-Free Distilled H2O, Thermo Fisher Scientific #10977-049). The ligation was performed at 55 °C for 1h ...
-
bioRxiv - Biophysics 2020Quote: ... made of 5:1:1 ratio of H2O: H2O2 (50 wt. % in H2O, stabilized, Fisher Scientific): NH4OH (ACS reagent ...
-
bioRxiv - Cell Biology 2020Quote: ... made of 5:1:1 ratio of H2O: H2O2 (50 wt. % in H2O, stabilized, Fisher Scientific): NH4OH (ACS reagent ...
-
bioRxiv - Cell Biology 2021Quote: ... made of 5:1:1 ratio of H2O : H2O2 (50 wt. % in H2O, stabilized, Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... resuspended in nuclease-free H2O (Ambion) and quantified using a NanoDrop 2000c spectrophotometer and/or a Qubit fluorometer with the Qubit RNA HS Assay kit (Life Technologies).
-
bioRxiv - Neuroscience 2024Quote: ... and 0.075 μL of H2O (Gibco) per tube ...
-
bioRxiv - Cell Biology 2024Quote: ... in nuclease free H2O (Ambion, AM9930)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1:2000 Cyclin D3 from Thermo Fisher (Waltham, MA, USA), 1:1000 Cyclin D2 from Proteintech (Rosemont ...
-
bioRxiv - Neuroscience 2024Quote: ... Texas Red™-conjugated dextran (TxR-d3, 3 kDa; ThermoFisher) at 0.05% in filtered artificial CSF (Tocris) ...
-
bioRxiv - Neuroscience 2024Quote: ... for hCMEC/D3 cells or Geltrex matrix (ThermoFisher Scientific #A1413201). Cells were fixed in 4% paraformaldehyde for 10 minutes and permeabilized with 0.25% Triton-X in PBS for 10 minutes prior to antibody incubation ...
-
bioRxiv - Neuroscience 2021Quote: ... NSC media was switched to “D3” differentiation media (DMEM/F12 Gibco #11330032 ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 mg/ml in H2O (Thermo Fisher).
-
bioRxiv - Cell Biology 2021Quote: ... HBVP and hCMEC/D3 were detached by 0.05% trypsin/EDTA (ThermoFisher Scientific) and resuspended in warm OM ...
-
bioRxiv - Neuroscience 2023Quote: ... Texas Red™-conjugated dextran (TxR-d3, 3 kDa; ThermoFisher Scientific, UK) at 0.05% in filtered artificial CSF (Tocris ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3.4 ul of Nuclease Free H2O (Ambion, AM9937), 0.2 µl of 20 µM Nested FW primer (5’ - AGGCTAAGGCTAATACATCTTCTG – 3’ ...
-
bioRxiv - Genomics 2021Quote: ... H2O pH 7.4) containing protease inhibitors (Thermo Scientific). After final wash and spin ...