Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for Kallikrein 3 PSA Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: Human embryonic kidney cells (HEK293) were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Gibco #12430-054) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2023Quote: Human embryonic kidney (HEK293, HEK293A) cell lines were grown in Dulbeco’s Modified Eagle medium (DMEM, Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Bioengineering 2022Quote: ... and 1% (v/v) penicillin-streptomycin-amphotericin B (PSA; Thermo Fisher Scientific, #15240062). All experiments were conducted at passage 3 with media replenished every 2 days ...
-
bioRxiv - Bioengineering 2022Quote: ... and 1% (v/v) penicillin-streptomycin-amphotericin B (PSA; Thermo Fisher Scientific, #15240062). All experiments were performed at passage 3 with media replaced every 2 days ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA from HEK293 cells and human brain prefrontal cortex were isolated with the TRIzol reagent (Ambion) according to the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2020Quote: Human Embryonic Kidney 293 cells (HEK293, ATCC CRL-1573) were grown under standard conditions in DMEM (Gibco) supplemented with 10% FBS (BioConcept) ...
-
bioRxiv - Neuroscience 2023Quote: The human embryonic kidney cells (HEK293 and HEK293T) were maintained in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) supplemented with 15% Fetal Bovine Serum (FBS ...
-
bioRxiv - Biochemistry 2022Quote: HEK293 and commercially available Flp-In T-REx HEK293 cells (Invitrogen; R78007) were cultured in DMEM (GIBCO ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 cells (ThermoFisher Scientific) were cultured in DMEM/F-12 ...
-
bioRxiv - Bioengineering 2022Quote: ... FreeStyle HEK293 cells (ThermoFisher) were used for recombinant S protein production ...
-
bioRxiv - Molecular Biology 2019Quote: ... HEK293 FT cells (ThermoFisher) were co-transfected with plasmids pCMV-dR8.2 dvpr (gag-pol ...
-
bioRxiv - Synthetic Biology 2019Quote: HEK293 cells (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: HEK293 cells (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293-FT (Invitrogen # R70007) cells were grown in Dulbecco’s Modified Eagle Medium (ThermoFisher #11965118 ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 (Thermo Fisher Scientific) were cultured in DMEM (Dulbecco’s Modified Eagle Medium ...
-
bioRxiv - Developmental Biology 2023Quote: HEK293 cells were transfected with 3 μg of linearised plasmid using Lipofectamine 3000 Transfection Reagent (Invitrogen, #L3000001) in wells of a 6-well plate ...
-
bioRxiv - Cell Biology 2023Quote: Human embryonic kidney (HEK293) cells were obtained from ATCC and cultured in Dulbecco’s Modified Eagle’s medium (DMEM, Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids were then transfected into human embryonic kidney cells (HEK293-E, National Research Council, Canada) using 293Fectin (Thermofisher). Six days post-transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 10ng/ml recombinant human IL-3 (Gibco). Cultured cells were infected with lentivirus encoding GFP/Scrambled control shRNA overnight and fresh media was added the following day ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μg of mammalian expression vector plasmids based on pEF1α V5 His C (Invitrogen) encoding codon-optimized gH ...
-
bioRxiv - Microbiology 2019Quote: ... the sequence coding for vpa0226 was amplified using primers 5’ GATCCTGCAGATGCTTAAAATTAAACTGCCT 3’ and 5’ GATA GAATTCTTACTTATCGTCGTCATCCTTGTAATC 3’ and then cloned into the pBAD/Myc-His vector (Invitrogen, resistance changed from ampicillin to kanamycin ...
-
bioRxiv - Neuroscience 2023Quote: ... Full-length human LRRC4B was subcloned and inserted into the pcDNA6-V5-His vector (Invitrogen). FAM19A5 (NM_001252310.1 ...
-
bioRxiv - Neuroscience 2024Quote: ... After blocking supernatant samples from different groups and standards (recombinant human-TREM2-His; Life Technologies) were incubated for 2 h at room temperature (RT ...
-
bioRxiv - Biochemistry 2022Quote: HEK293 wild type (ATCC, #CRL-1573) and HEK293 Flp-in T-REx (ThermoFisher, #R78007) wild type cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Molecular Biology 2024Quote: HEK293 Flp-In T-REx cells (or HEK293 T-REx; Thermo Fisher Scientific, R78007) and HEK293 cells [American Type Culture Collection (ATCC) ...
-
bioRxiv - Cancer Biology 2021Quote: HEK293-FT (Thermo Fisher Scientific) were cultured in DMEM supplemented with 10% FBS ...
-
bioRxiv - Bioengineering 2021Quote: ... HEK293 Freestyle suspension cells (ThermoFisher), and immortalized human cord blood-derived mesenchymal stromal cells (cbMSCs ...
-
bioRxiv - Neuroscience 2020Quote: HEK293-FT (RRID:CVCL_6911, Thermo Scientific) cells were grown in DMEM containing 10% FBS ...
-
bioRxiv - Molecular Biology 2022Quote: HEK293-FlpIn cells (ThermoFisher Scientific) were transfected with empty vector (negative control ...
-
bioRxiv - Biochemistry 2022Quote: HEK293 FlpIn-TRex cells (Invitrogen) were cultured in DMEM (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: HEK293 FlpIn-TRex cells (Invitrogen) were cultured in DMEM (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293-FT (Thermo Fisher Scientific) were cultured in DMEM with 10% FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293-FT (Thermo Fisher Scientific) in DMEM with 10% FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293-F cells (ThermoFisher R79007) were transfected with the transfer plasmid and the packaging plasmids (Addgene plasmids #12263 and #8454 ...
-
bioRxiv - Cell Biology 2019Quote: ... After incubation at room temperature for 1.5 h with FITC-PSA (2 mg/ml; Invitrogen), they were washed with PBS for three times ...
-
bioRxiv - Molecular Biology 2019Quote: ... The knottin Fc fusion proteins were expressed in human embryonic kidney (HEK293) cells following the manufacturer’s protocols in the FreeStyle MAX 293 Expression System (Invitrogen). Secreted knottin-Fc fusion proteins were purified using Protein A Sepharose (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Human parental HEK293 cells (ATCC, CRL-1573) were cultured in DMEM supplemented with 10% FBS and antibiotics/antimycotics (Gibco).
-
bioRxiv - Biochemistry 2023Quote: Human embryonic kidney (HEK293) and A549 cell lines were maintained in Dulbecco’s Modified Eagle Medium (Thermo Fisher Scientific, Lithuania) containing 10% heat-inactivated fetal bovine serum (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... Protein expression was achieved by transient transfection of FreeStyle human embryonic kidney 293 (HEK293-F) cells (Thermo Fisher Scientific). Cells were grown in non-baffled shake flasks (Corning ...
-
bioRxiv - Molecular Biology 2020Quote: ... in 1.5ml of SD/-Leu/-His liquid medium (plus 3 mM 3-AT) were incubated in a 12-well microplate (Thermo Scientific) at 30°C for 96 hours (h) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 μg/ml of human ⍺-CD3 (Thermo Fisher Scientific), 5 μg/ml of human ⍺-CD28 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... HEK293 cells stably transfected with human CXCR4 (HEK293- CXCR4) were used at passage 5 and were cultivated in DMEM medium (Gibco), supplemented with 10% FCS and 1% penicillin/streptomycin (Gibco) ...
-
bioRxiv - Molecular Biology 2020Quote: The template RNA for cDNA synthesis was isolated from human HEK293 cell culture with TRIzol reagent (Thermo Fisher Scientific, USA), or FFPE samples ...
-
bioRxiv - Developmental Biology 2022Quote: Human HEK293 cells were maintained at 37°C in complete media consisting of DMEM with high glucose GlutaMAX Supplement (Gibco) and 10% Fetal Bovine Serum ...
-
bioRxiv - Molecular Biology 2023Quote: Human embryonic kidney (HEK293) cells (RIKEN Cell Bank, Japan) were cultured in Dulbecco’s Modified Eagle Medium (DMEM, GIBCO, 11965-092) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Bioengineering 2024Quote: Human Embryonic Kidney (HEK293; ATCC Ref: CRL-1573) cells were cultured in Dulbecco’s Modified Eagle Medium + GlutaMAX (Gibco; 10569-010) supplemented with 10% fetal bovine serum (Biowest ...
-
bioRxiv - Bioengineering 2024Quote: Human Embryonic Kidney (HEK293; ATCC Ref: CRL-1573) cells were cultured in Dulbecco’s Modified Eagle Medium + GlutaMAX (Gibco; 10569-010) supplemented with 10% fetal bovine serum (Biowest ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 stably expressing the tetracycline (tet)-repressor (Flp-In T-REx HEK293, Invitrogen, Carlsbad, CA, USA) were cultured as above with the addition of 50 μg/mL zeocin and 5 μg/mL blasticidin (Invitrogen ...
-
bioRxiv - Biochemistry 2019Quote: HEK293 cells: HEK293 cells (CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045) were cultured in DMEM high glucose (Gibco) and supplemented with 10% FCS (Gibco) ...
-
bioRxiv - Biochemistry 2021Quote: ... FreeStyle HEK293 cells (Thermo fisher scientific) were transfected with pcDNA3.1 vector encoding for HSulf-2 cDNA flanked by TEV cleavable SNAP (20.5 kDa ...