Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for Interleukin 10 Receptor Beta IL10RB Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... 100 uM Beta-mercaptoethanol (31350010, ThermoFisher Scientific), 1X Non-Essential amino acids (11140050 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 0.1% beta-mercaptoethanol (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2023Quote: ... and 50µM beta-2- mercaptoethanol (ThermoFisher Scientific). The next day drug concentrations were increased to 10μg/ml puromycin (Invivogen ...
-
bioRxiv - Systems Biology 2024Quote: ... 0.1 mM beta-mercaptoethanol (Gibco™ 31350010) and 500 U/mL recombinant leukemia inhibitory factor (LIF ...
-
Loss of intermicrovillar adhesion impairs basolateral junctional complexes in transporting epitheliabioRxiv - Cell Biology 2024Quote: ... anti-Beta-Catenin (rabbit, Invitrogen #71-2700), 1:100 ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.2 % beta-mercaptoethanol (Thermo Fisher, 31350-010), 1 % Pen/Strep (ThermoFisher ...
-
bioRxiv - Biochemistry 2021Quote: ... for spike protein or RBD detection and mouse anti-beta tubulin antibody (1:5000; Thermo Fisher; MA5-16308) as a loading control ...
-
bioRxiv - Immunology 2020Quote: ... pH 7.2) resuspended and incubated for 30 min in FACS buffer supplemented with Fc gamma receptor CD16/CD32 antibodies (ThermoFisher). Cells were then incubated with Alexa fluor 488-conjugated antibodies against F4/80 or rat IgG2a kappa isotype control ...
-
bioRxiv - Immunology 2020Quote: ... Reverse sICs were generated from these receptor-specific antibodies using goat-anti-mouse IgG F(ab)2 fragments (Invitrogen) in a 1:1 ratio ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies were used: rabbit polyclonal anti-GPR10 receptor (1:200; PA5-29809 Thermo Scientific, Paisley, UK); rabbit polyclonal anti-NPFF2 receptor (1:200 ...
-
Analysis of RyR2 distribution in HEK293 cells and mouse cardiac myocytes using 3D MINFLUX microscopybioRxiv - Physiology 2023Quote: ... after the samples were blocked the cells were incubated with a ryanodine receptor monoclonal antibody (C333) (MA3-916, Invitrogen) overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Transferrin (loading control) was detected with mouse anti-human transferrin receptor antibody (1:500, Cat# 136800, Invitrogen, Waltham, MA). Protein samples (50 µg ...
-
bioRxiv - Microbiology 2022Quote: ... cells and baby hamster kidney 21 cells expressing the MHV receptor (BHK-R)(47) were maintained in DMEM containing 10% FBS (Invitrogen), 100 U/ml penicillin ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293A cells expressing dopamine receptor sensors or other constructs were prepared on cover-glass-bottom dishes coated with 10 μg/ml of fibronectin (Gibco). Various concentration of dopamine or other ligands were added to the cells ...
-
bioRxiv - Physiology 2023Quote: ... nearly 106 cells were first incubated on ice for 30 minutes in a solution consisting of a 1:10 Fc Receptor Binding Inhibitor (eBiosciences) and 1:500 Live/Dead Aqua stain (Invitrogen) diluted in PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... Transferrin receptor (clone H68.4, Invitrogen 13-6890, WB), β-actin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2019Quote: ... Receptors were coated down onto ELISA plates (Nunc) in carbonate buffer pH 9 (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... at 4 °C (oxytocin receptor (Thermo Fisher Scientific): 1:400 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-Transferrin Receptor (1:1000, 13-6800, Invitrogen), anti-LC3B (1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-Transferrin Receptor (1:100, 13-6800, Invitrogen), anti-LC3B (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... H68.4 for transferrin-receptor (Invitrogen, cat. # 13-6800), mouse HRD1 (Cell Signaling ...
-
bioRxiv - Cancer Biology 2023Quote: ... and transferrin receptor (ThermoFisher 13-6800, 1:1,000) antibodies.
-
bioRxiv - Biochemistry 2024Quote: ... and the transferrin receptor (Life technologies 13-6890) at 4 °C overnight ...
-
bioRxiv - Cancer Biology 2020Quote: ... One ng/mL recombinant human interleukin (IL)-6 (Gibco, Thermo Fisher Scientific, Waltham, MA, USA), was added to the media of the IL-6 dependent myeloma cell lines INA-6 ...
-
bioRxiv - Neuroscience 2022Quote: ... using samples diluted to 1:1000 while interleukin (IL)-6 (Thermo Fisher Scientific, Cat. #BMS625) was evaluated using samples diluted 1:2 ...
-
bioRxiv - Bioengineering 2023Quote: ... and mature macrophages were polarized by adding 20 ng/ml Interleukin-4 (IL4, A42602, Invitrogen) plus 20ng/ml IL13 (A42526 ...
-
bioRxiv - Immunology 2024Quote: ... and recombinant human interleukin 4 (rhIL-4) (300 U/mL; Thermo Fisher Scientific, Waltham, MA). On day 2 and day 5 post-monocyte isolation ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies for one series included rabbit anti-beta Amyloid (1:300, Cat# 715800, Lot# SH257822; Invitrogen, Waltham, MA). Primary antibodies for another series included rat anti-glial fibrillary acidic protein (1:2500 ...
-
bioRxiv - Microbiology 2023Quote: ... NP and 250 ng of pPolI plasmid encoding a mvRNA were transfected alongside 100 ng of plasmid expressing firefly luciferase from the IFN-beta promoter and 10 ng of plasmid expressing Renilla luciferase using Lipofectamine 2000 (Invitrogen) to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2020Quote: ... supernatants were diluted 4-fold and assayed with the Amyloid beta 40 Human ELISA Kit and either the Amyloid beta 42 Human ELISA Kit or the Amyloid beta 42 Human ELISA Kit Ultrasensitive (Invitrogen), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Beta-2-Microglobulin-Mm00437762_m1 (Applied Biosystems, Waltham, MA). Gene expression levels were normalized to β-2-microglobulin ...
-
bioRxiv - Developmental Biology 2019Quote: ... 4ng/ml beta-FGF (Thermo Scientific®; RFGFB50), 50nM PMA (Sigma ...
-
bioRxiv - Bioengineering 2021Quote: ... or mouse monoclonal anti-beta tubulin (MA516308, Invitrogen) antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... and Beta-Actin (Mm02619580_g1) were from Applied Biosystems. The following forward and reverse primers were used to amplify VSig4 - 5’ GGAGATCTCATCAGGCTTGC3’ and 5’CCAGGTCCCTGTCACACTCT ...
-
bioRxiv - Cell Biology 2022Quote: ... normalization using either beta-actin (Hs99999903_1, Applied Biosystems) or GAPDH (Hs03929097_g1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.1 mM beta-mercaptoethanol (Invitrogen, Cat# 31350-010), 2 mM L-glutamine (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... Beta-actin (Catalog # MA5-11869, ThermoFisher Scientific Inc), VDAC1 (Catalog # ab 15895 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.1 mM Beta-Mercaptoethanol (Gibco, Cat. No. 31350010), 1000 units/mL LIF (Millipore ...
-
bioRxiv - Cell Biology 2019Quote: ... rabbit anti-Beta Galactosidase (1:1000, Life Technologies), mouse anti-Beta Galactosidase (1:1000 ...
-
bioRxiv - Genomics 2021Quote: ... 2 μl of beta-agarase (Thermo Fisher Scientific) were added for agarose digestion and the reaction was incubated at 43 °C for 45 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.1 mM Beta-mercaptoethanol (Fisher Scientific, #21985-023), Primocin (Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.055 mM beta-mercaptoethanol (Thermo Fisher Scientific), with fresh medium added weekly ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2% n-Dodecyl-beta-Maltoside Detergent (Thermo Scientific). For lysis tests ...
-
bioRxiv - Microbiology 2023Quote: ... and beta-actin (Thermo Fisher Scientific, MA5-15739). Fluorescent secondary antibodies were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human Beta-2-Microglobulin (B2M) (ThermoFisher, Cat# 4333766T) served as an endogenous control for RNA input ...
-
bioRxiv - Neuroscience 2024Quote: ... and 400 uL of beta-mercaptoethanol (Life Technologies).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 0.1% beta-Mercaptoethanol (2-Me; Gibco, Darmstadt, Germany) and 100 U/ml Penicillin and 100 μg/ml Streptomycin at 37 °C in a humidified environment at 5% CO2.
-
bioRxiv - Neuroscience 2020Quote: Cells were incubated with anti-human Fc receptor (0,005 µg/ml eBioscience, 14-9161-73) for 10 min in Medium A without phenol red (HBSS (Gibco, 14170-053) containing 15 mM HEPES (Lonza ...
-
bioRxiv - Neuroscience 2022Quote: ... Membranes were incubated with the primary antibodies (α-TSPAN5, Aviva System biology #AV46640, 1:500; α-transferrin receptor, Thermo Fisher Clone H68.4 ...
-
bioRxiv - Immunology 2021Quote: ... or with an antibody against the nicotinic acetylcholine receptor ɑ7 (nAChr ɑ7; Alomone Labs) followed by an Alexa594 goat-anti-rabbit conjugate (Invitrogen). Nuclear counterstain with Hoechst 33342 (Sigma ...