Labshake search
Citations for Thermo Fisher :
301 - 350 of 8762 citations for IL 8 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... IL-6 (20 ng/mL, ThermoFisher). To generate human induced pluripotent stem cells (iPSCs) ...
-
bioRxiv - Neuroscience 2019Quote: ... IL-3 (20 ng/mL, ThermoFisher), IL-6 (20 ng/mL ...
-
bioRxiv - Cancer Biology 2019Quote: ... 100ng/ml IL-4 (Gibco, USA) for 48h ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 ng/ml IL-10 (Gibco), 2.5 μg/ml CpG oligodeoxynucleotide 2006 (TCGTCGTTTTGTCGTTTTGTCGTT ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 ng/ml IL-4 (Gibco), 10 ng/ml IL-10 (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... caveolin-2 (Thermo Fisher, Rockford, IL), and STIM1/CRACR2A (CRAC regulator 2A ...
-
bioRxiv - Microbiology 2021Quote: ... anti-mouse IL-1β (Invitrogen, # 701304); anti-mouse Cleaved IL-1β (Cell Signaling Technology ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylbenzidine (ThermoFisher Scientific, Rockford, IL, USA) and read at 450 nm according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: ... SyberGreen (Thermo Fisher, Rockford, IL, USA), forward and reverse primers (IDT ...
-
bioRxiv - Immunology 2020Quote: ... IL-18 Mouse ELISA kit (ThermoFisher), and ELISA MAX Deluxe Set Mouse TNFα (Biolegend) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... in duplicate by ThermoFisher (Life Technologies Corporation, Chicago, IL 60693) using Z’Lyte (76) ...
-
bioRxiv - Neuroscience 2019Quote: ... IL-10 (ThermoFisher Scientific, Waltham, MA), and IL-1β (R&D Systems ...
-
bioRxiv - Immunology 2021Quote: ... IL-4 (Invitrogen, #12-7041-41) and Foxp3 (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... and anti-IL-2 APC (Invitrogen) in permeabilization buffer for 30 min ...
-
bioRxiv - Physiology 2021Quote: ... TRIzol reagent (Thermo Scientific, Rockford, IL) was used to extract the total RNA from pepper and N ...
-
bioRxiv - Immunology 2020Quote: ... anti-mouse IL-6 (ThermoFisher, USA), Alexa Fluor® 594 conjugate secondary antibody (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... anti-mouse IL-2 (ThermoFisher, USA), Alexa Fluor® 594 conjugate secondary antibody (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-IL-1β antibody (Invitrogen), mouse anti-MCP-1 antibody (Abcam) ...
-
bioRxiv - Immunology 2022Quote: ... IL-6 (100 ng/ml, Invitrogen), TNF-α (10 ng/ml ...
-
bioRxiv - Immunology 2022Quote: ... IL-17A (Invitrogen, #88-7371-88), or IL-5 (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... and anti-IL-13-PECy7(Invitrogen 25-7133-82 ...
-
bioRxiv - Immunology 2022Quote: ... TNF-α and IL-6 (ThermoFisher) protein levels were measured by ELISA ...
-
bioRxiv - Neuroscience 2023Quote: ... IL-13 (Thermofisher, #88-7137-88) and NPY (Cusabio ...
-
bioRxiv - Immunology 2023Quote: ... IL-10 (Invitrogen, #88-7105-88), IL-12p70 (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... IL-12p70 (Invitrogen, #88-7121-88), and INFγ (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... and IL-1β by ELISA (Invitrogen). Protein levels of RANTES (CCL5) ...
-
bioRxiv - Immunology 2023Quote: ... IL-6 (Invitrogen, #88-7064-22), and IL-1β (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... IL-6 (Invitrogen, #88-7066-88), IL-8 (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... IL-15(10ng/ml, Thermo Fisher).
-
bioRxiv - Immunology 2023Quote: ... Th1: 10ng/ml IL-12 (ThermoFisher), 10ng/ml IL-2 (ThermoFisher) ...
-
bioRxiv - Immunology 2023Quote: ... IL-17A (Invitrogen #88-7371-88), or IL-5 (BD Biosciences #51-1805KZ ...
-
bioRxiv - Immunology 2023Quote: ... IL-13 PE/Cy7 (eBio13A, Invitrogen), IL-5 APC (TRFK5 ...
-
bioRxiv - Neuroscience 2023Quote: ... Enhanced chemiluminescence (Thermo Scientific, IL, USA) was used to see the bands ...
-
bioRxiv - Immunology 2023Quote: ... IL-10 (JES5-16E3, APC, Invitrogen), and GM-CSF (MP1-22E9 ...
-
bioRxiv - Cell Biology 2023Quote: ... DAB Substrate (Thermo Scientific, Rockford, IL) was used to achieve peroxidase reaction followed by hematoxylin (Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: ... and IL-10 (ProcartaPlex, Thermo Fisher) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... anti-IL-4-PB (Thermo Fisher Scientific Cat# 48-0042-82 ...
-
bioRxiv - Immunology 2024Quote: ... and anti-IL-2-PE (Affymetrix eBioscience ...
-
bioRxiv - Immunology 2024Quote: ... mouse IL-1beta (Invitrogen™ 88701388), human IL-8 (Invitrogen™ 88808677) ...
-
bioRxiv - Immunology 2022Quote: ... samples were resuspended in binding buffer containing a 1:100 dilution of mouse anti-human-IgG1-Fc conjugated to Alexa Fluor 488 (Thermo Fisher Scientific, Rockford, IL; A-10631) and incubated for 30 minutes at room temperature in the dark ...
-
bioRxiv - Immunology 2023Quote: ... recombinant human IL-3 (R&D, Cat. 203-IL-050/CF, 25 ng mL-1) or c) human M-CSF recombinant protein (Invitrogen, Cat. PHC9501, 100 ng mL-1). A partial medium change was performed every 48 hours with 2x cytokine composites to replenish cytokines ...
-
bioRxiv - Neuroscience 2021Quote: ... while levels of IL-6 in supernatants were determined using IL-6 mouse ELISA kit (Thermo Scientific). Similarly ...
-
bioRxiv - Immunology 2021Quote: ... previously cultured for 24h with IL-15/IL-15R complex recombinant protein (100ng/ml, Thermo Fisher Scientific) and retinoic acid (100ng/ml) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the anti-inflammatory cytokine IL-10 were detected using specific mouse IL-1β (Invitrogen, California, USA), IL-6 (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... the supernatants were collected and we measured the IL-1β concentrations using IL-1β ELISA kits (Invitrogen) and following manufacturer instructions.
-
bioRxiv - Immunology 2023Quote: IL-1β secretion was detected by IL-1 beta Mouse Uncoated ELISA Kit (88-7013-88; Invitrogen) following the manufacturer’s protocol.
-
bioRxiv - Microbiology 2024Quote: ... and human (goat anti-human IgG, ThermoFisher) were also used ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 8% FBS (GIBCO) and 20% L929 supernatant and antibiotics (penicillin ...
-
bioRxiv - Plant Biology 2022Quote: ... Di-8-ANEPPS (Molecular Probes, Life Technologies ...
-
bioRxiv - Immunology 2022Quote: 8-well Labtek chambers (Nunc) were coated with 15 μg/ml of anti-IgM and/or anti-IgG with or without 0.5 μg/ml of mouse histidine-tagged ICAM-1 (Sino Biological ...