Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for IL 10 Mouse CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Anti-mouse IL-10 and anti-mouse IL-13 antibodies were purchased from Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: Secreted IL-10 was determined by ELISA as per the manufacturer’s protocol (Mouse IL-10, Invitrogen, No: 88-7105-88). The color reaction was measured as OD450 units on a Bio-Rad iMark microplate reader ...
-
bioRxiv - Immunology 2022Quote: ... and IL-10 Mouse Uncoated ELISA Kit (88-7105-86, Invitrogen), respectively ...
-
bioRxiv - Immunology 2023Quote: ... anti-mouse IL-10 detection (Invitrogen, #88-7105-88, 1:250), biotin anti-mouse IFN-ψ (BD Biosciences ...
-
bioRxiv - Immunology 2023Quote: ... anti-mouse IL-10 capture (Invitrogen, #88-7105-88, 1:250), purified anti-mouse IFN-ψ (BD Biosciences ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the anti-inflammatory cytokine IL-10 were detected using specific mouse IL-1β (Invitrogen, California, USA), IL-6 (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... Mouse Aspn expressing CHO cells were cultured in Alpha MEM (Gibco) medium supplemented with 10% Dialyzed serum (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... IL-10 (ThermoFisher) was added at 10ng/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... CHO cells were cultured in CD CHO medium (ThermoFisher). Anti-human CD45 (hCD45)-BV421 ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 ng/ml IL-10 (Gibco), 2.5 μg/ml CpG oligodeoxynucleotide 2006 (TCGTCGTTTTGTCGTTTTGTCGTT ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 ng/ml IL-6 and 10 ng/ml IL-3 (Gibco). Inpp4b+/+ and Inpp4b-/- LSK were each retrovirally transduced with pMSCV-MLL-AF9-IRES-mVenus ...
-
bioRxiv - Bioengineering 2021Quote: ... IL-10 (Thermofisher Scientific), C3 ...
-
bioRxiv - Neuroscience 2022Quote: ... IL-10 (ThermoFisher Scientific), C3 ...
-
bioRxiv - Immunology 2023Quote: ... IL-10 (Invitrogen, #EHIL10), IL-12p70 (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: CHO-K1 cells stably expressing human RXFP4 (hRXFP4-CHO) or RXFP3 (hRXFP3-CHO) were maintained in DMEM/F12 (Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Biochemistry 2022Quote: ... The drug-selected recombinant CHO-S cells were adapted to serum-free suspension culture using CHO-S medium (CD Forti CHO; ThermoFisher). For large-scale cultures ...
-
bioRxiv - Bioengineering 2020Quote: ... the CHO K1 cells were cultured in CD CHO medium (Gibco, USA). The viable and total cell counts were determined by ViCell (Beckman ...
-
bioRxiv - Systems Biology 2019Quote: ... and CHO-DG44 (Gibco™ catalog number 12609-012 ...
-
bioRxiv - Cancer Biology 2019Quote: CHO-S (Invitrogen; CVCL_7183), CT26.WT (ATCC ...
-
bioRxiv - Microbiology 2021Quote: ... IL-10 (JES5-16E3, Thermofisher) IL-17A (eBio17B7 ...
-
bioRxiv - Neuroscience 2021Quote: ... IL-6 and IL-1β using mouse ELISA kits (Thermo Scientific).
-
bioRxiv - Biochemistry 2020Quote: ... Plasmids were transiently transfected into CHO cells using ExpiFectamine CHO Transfection Kit (ThermoFisher), and protein was purified one the sixth day post-transfection ...
-
bioRxiv - Microbiology 2021Quote: ... anti-mouse IL-1β (Invitrogen, # 701304); anti-mouse Cleaved IL-1β (Cell Signaling Technology ...
-
bioRxiv - Immunology 2020Quote: ... IL-18 Mouse ELISA kit (ThermoFisher), and ELISA MAX Deluxe Set Mouse TNFα (Biolegend) ...
-
bioRxiv - Immunology 2020Quote: ... anti-mouse IL-6 (ThermoFisher, USA), Alexa Fluor® 594 conjugate secondary antibody (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... anti-mouse IL-2 (ThermoFisher, USA), Alexa Fluor® 594 conjugate secondary antibody (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-IL-1β antibody (Invitrogen), mouse anti-MCP-1 antibody (Abcam) ...
-
bioRxiv - Immunology 2024Quote: ... mouse IL-1beta (Invitrogen™ 88701388), human IL-8 (Invitrogen™ 88808677) ...
-
bioRxiv - Microbiology 2020Quote: ... To measure IL-10 serum levels the IL-10 Monkey ELISA Kit (Thermo Fisher, Waltham) was used according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... IL-18 was assayed using the IL-18 Mouse ELISA Kit (Invitrogen) according to the instructions.
-
bioRxiv - Biochemistry 2020Quote: ... with a feeding of 10% (v/v) CHO CD EfficientFeed B (Thermo Fisher Scientific) on days 3 ...
-
bioRxiv - Bioengineering 2020Quote: ... CD CHO was from Gibco, MSX ...
-
bioRxiv - Biophysics 2022Quote: ... T-REx-CHO (Thermo Fisher) and HEK293S GnTI-were used for stable expression ...
-
bioRxiv - Immunology 2020Quote: ... CHO-S cells from Invitrogen. Cells were handled according to supplier’s protocol and maintained as cryopreserved aliquots in liquid nitrogen ...
-
bioRxiv - Bioengineering 2022Quote: ... CHO-S cells (ThermoFisher Scientific) were grown in Freestyle CHO expression medium (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... interleukin-10 (IL-10) and interleukin-4 (IL-4) levels by sandwich ELISA kits (ThermoFisher Scientific). The measurement from unstimulated splenocytes (incubated with medium only ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 ng/ml IL-4 (Gibco), 10 ng/ml IL-10 (Gibco) ...
-
bioRxiv - Neuroscience 2019Quote: ... IL-10 (ThermoFisher Scientific, Waltham, MA), and IL-1β (R&D Systems ...
-
bioRxiv - Immunology 2023Quote: ... IL-10 (Invitrogen, #88-7105-88), IL-12p70 (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... IL-10 (JES5-16E3, APC, Invitrogen), and GM-CSF (MP1-22E9 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and IL-10 (ProcartaPlex, Thermo Fisher) according to manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Human V1A Receptor-CHO cell line (CHO -V1a) was cultured in Ham’s F12 (Life Technologies) supplemented with 10% fetal bovine serum (Life Technologies ...
-
bioRxiv - Bioengineering 2022Quote: ... GFP-overexpressing CHO-K1 cells (Linterna CHO-K1, Innoprot) were cultivated in DMEM (ThermoFisher Scientific) supplemented with 1% Penicillin/Streptomycin ...
-
bioRxiv - Immunology 2021Quote: ... IL-6 mouse ELISA kit (ThermoFisher Scientific) and IL-1β mouse ELISA kit (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... IL-6 Mouse ELISA kit (ThermoFisher, USA) was used ...
-
bioRxiv - Cell Biology 2022Quote: ... and mouse anti-IL-1β antibody (Invitrogen) and Alexafluor 555 donkey anti-rabbit and Alexafluor 488 donkey anti-mouse antibodies (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... IL-2 ELISA was performed using IL-2 Mouse Uncoated ELISA Kit (Invitrogen) following manufacturer’s protocol.
-
bioRxiv - Immunology 2023Quote: TAP2 deficient CHO cells were cultured in complete RPMI (Invitrogen, 2mM glutamine and 10% FCS) and stably-transfected with >10g plasmid DNA using poly-L-ornithine and a 30% DMSO shock ...
-
bioRxiv - Neuroscience 2024Quote: Chinese hamster ovary (CHO) K1 cells were cultured in F12 medium with 10% FBS (Gibco). Penicillin/streptomycin (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... TNFα and IL-10 levels were measured by TNFα Mouse Uncoated ELISA Kit (88-7324-86, Invitrogen) and IL-10 Mouse Uncoated ELISA Kit (88-7105-86 ...