Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for IL 10 Human HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: Human embryonic kidney (HEK293, Thermo Fisher Scientific) cells ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 10 ng/ml recombinant human IL-2 (Gibco, Thermo Fisher), 10% heat-inactivated Fetal Calf Serum (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 10 ng/ml recombinant human IL-2 (Gibco, Thermo Fisher), 10% heat-inactivated Fetal Calf Serum (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... and the Human embryonic kidney (HEK293) cells (Gibco) in Freestyle F17 expression medium (Gibco) ...
-
bioRxiv - Neuroscience 2022Quote: Human derived HEK293 cells (Invitrogen, Inchinnan, UK, R75007) stably transfected with cAMP GloSensor™ (pGloSensor-22F ...
-
bioRxiv - Neuroscience 2023Quote: Grip TiteTM Human Embryonic Kidney (GT HEK293) (Invitrogen) cells were grown as previously described (Chałupnik et al ...
-
bioRxiv - Immunology 2022Quote: ... 2-mercaptoethanol (RP-10) and 10 ng/ml recombinant human IL-2 (Thermo Fisher Scientific) for 18-22 hours ...
-
bioRxiv - Neuroscience 2023Quote: Human Embryonic Kidney Grip TiteTM (HEK293-GT) cells (Invitrogen) was used to create a polyclonal cell line expressing GluA2(Q)i as previously described [49] ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Immunology 2021Quote: Human embryonic kidney cells (HEK293) were maintained in IMDM (Gibco) supplemented with 10% FCS and 1% penicillin/streptomycin (Invitrogen) ...
-
bioRxiv - Molecular Biology 2022Quote: Human Embryonic Kidney (HEK293) T-Rex Flp-In (ThermoFisher Scientific) cells were grown in DMEM supplemented with 10% FBS in an atmosphere of 5% CO2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Human embryonic kidney cell lines (HEK293) containing a Flp-In expression vector (HEK293 Flp-In) obtained from ThermoFisher Scientific were utilized in this study ...
-
bioRxiv - Cell Biology 2020Quote: ... Human IL-6 and IL-8 ELISAs were from Thermofisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... IL-2 was measured by human IL-2 ELISA (Invitrogen) using the manufacturer instructions ...
-
bioRxiv - Immunology 2021Quote: ... IL-10 (ThermoFisher) was added at 10ng/ml ...
-
bioRxiv - Immunology 2021Quote: ... and Human IL-1β from ThermoFisher.
-
bioRxiv - Immunology 2024Quote: ... human IL-1beta (Invitrogen™ 88726177) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... human IL-8 (Invitrogen™ 88808677), human IL-1beta (Invitrogen™ 88726177 ...
-
bioRxiv - Microbiology 2021Quote: ... Human parental HEK293 cells (ATCC, CRL-1573) were cultured in DMEM supplemented with 10% FBS and antibiotics/antimycotics (Gibco).
-
bioRxiv - Biophysics 2021Quote: ... Human embryonic kidney 293 cells (HEK293) were maintained in DMEM (Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Neuroscience 2021Quote: Human embryonic kidney (HEK293) were grown in DMEM/F12 media (GIBCO) supplemented with HyClone cosmic calf serum (GE Healthcare ...
-
bioRxiv - Bioengineering 2022Quote: Human embryonic kidney (HEK293) cells were cultured in DMEM (Thermofisher Scientific) containing 10 % Fetal Bovine Serum (FBS ...
-
bioRxiv - Bioengineering 2023Quote: ... Human Embryonic Kidney cells (HEK293-CD19+) were cultured in DMEM (Gibco), 10% heat-inactivated FBS (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 ng/ml IL-10 (Gibco), 2.5 μg/ml CpG oligodeoxynucleotide 2006 (TCGTCGTTTTGTCGTTTTGTCGTT ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 ng/ml IL-6 and 10 ng/ml IL-3 (Gibco). Inpp4b+/+ and Inpp4b-/- LSK were each retrovirally transduced with pMSCV-MLL-AF9-IRES-mVenus ...
-
bioRxiv - Bioengineering 2021Quote: ... IL-10 (Thermofisher Scientific), C3 ...
-
bioRxiv - Neuroscience 2022Quote: ... IL-10 (ThermoFisher Scientific), C3 ...
-
bioRxiv - Immunology 2023Quote: ... IL-10 (Invitrogen, #EHIL10), IL-12p70 (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... and of human IL-17A (Invitrogen #BMS2017) were determined in cell culture supernatants by ELISA ...
-
bioRxiv - Cancer Biology 2020Quote: ... purified recombinant human IL-8 (ThermoFisher Scientific) and CXCL1 (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2021Quote: ... 50 ng/mL human IL-21 (Invitrogen), 50 ng/mL human IL-4 (Miltenyi) ...
-
bioRxiv - Genetics 2020Quote: HEK293 and human fibroblast culture medium consisted of DMEM (Gibco; 11995-065) supplemented with 10% fetal bovine serum (Gibco 16000-036) ...
-
bioRxiv - Molecular Biology 2022Quote: Human embryonic kidney (HEK293; Invitrogen’s Flp-In-293 cell line cat #R75007) cells were grown and maintained in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Biochemistry 2022Quote: HEK293 (Human Embryonic Kidney 293-Flp-In T-Rex, Thermo Fisher Scientific) cells were cultured in DMEM (Dulbecco’s modified Eagle‘s medium ...
-
bioRxiv - Systems Biology 2023Quote: Different human cell lines (HeLa, HEK293) were cultured in DMEM (Gibco, Invitrogen), supplemented with 10% fetal bovine serum ...
-
bioRxiv - Neuroscience 2023Quote: HEK293 human kidney cells were cultured in D-MEM (Thermo Fisher Scientific), supplemented with 5% HyClone Cosmic Calf serum (Cytiva ...
-
bioRxiv - Systems Biology 2023Quote: Different human cell lines (HeLa, HEK293) were cultured in DMEM (Gibco, Invitrogen), supplemented with 10% fetal bovine serum ...
-
bioRxiv - Immunology 2021Quote: - IFNγ and IL-10 levels were measured in the supernatant of the WBA using IFN gamma and IL-10 Human ELISA Kit (Invitrogen) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2020Quote: ... Enzyme-linked immunosorbent assays (ELISAs) for human IL-8 were performed using the Human IL-8 ELISA Kit (ThermoFisher SCIENTIFIC) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: Human embryonic kidney (HEK293) cells were maintained in Dulbecco’s modified eagle medium (Gibco) containing 10% fetal bovine serum (HyClone) ...
-
bioRxiv - Neuroscience 2020Quote: Human embryonic kidney cells (HEK293) were cultured in Dulbecco’s modified Eagle’s media (Gibco) containing 10 % v/v fetal bovine serum (heat-inactivated ...
-
bioRxiv - Biochemistry 2020Quote: ... Human 28S and 18S rRNAs were extracted from HEK293 cells with TRIzol (Invitrogen). Intact rRNAs were isolated by pipetting from a native agarose gel after running the rRNA into wells in the center of the gel ...
-
bioRxiv - Physiology 2022Quote: ... HEK293 cells were transfected with human TRPA1 expressing plasmid using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: Human embryonic kidney (HEK293, ATCC #CRL-1573) cells were cultured in DMEM (Gibco), supplemented with 10% (vol/vol ...
-
bioRxiv - Cancer Biology 2022Quote: ... IL-8 Monocyte Recombinant Human Protein (ThermoFisher, PHC0884), and Recombinant Human CXCL1/GROα Protein (R&D Systems ...
-
bioRxiv - Immunology 2020Quote: Detection of human IL-1β and TNFα (Invitrogen) in hMDM culture supernatants were performed by sandwich ELISA ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant human IL-2 was purchased from ThermoFisher Scientific.
-
bioRxiv - Cancer Biology 2023Quote: ... and 10ng/ml recombinant human IL-3 (Gibco). Cultured cells were infected with lentivirus encoding GFP/Scrambled control shRNA overnight and fresh media was added the following day ...
-
bioRxiv - Neuroscience 2023Quote: ... and IL-1RA Human ELISA Kit (ThermoFisher, KAC1181). Protein concentrations were calculated per manufacturer’s instructions in pg/mL ...
-
bioRxiv - Microbiology 2021Quote: ... IL-10 (JES5-16E3, Thermofisher) IL-17A (eBio17B7 ...