Labshake search
Citations for Thermo Fisher :
101 - 150 of 225 citations for IGF1 Receptor since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The cells were stained with human FITC conjugated transferrin receptor (CD71; ThermoFisher: 11-0719-42) and human FITC conjugated glycophorin A (CD235a ...
-
bioRxiv - Neuroscience 2020Quote: ... IgG1 anti-transferrin receptor (TfR, clone H68.4, 1:500, ThermoFisher Scientific, catalog no. 13-6800), IgG1 anti-GAPDH (1:10,000 ...
-
bioRxiv - Physiology 2023Quote: ... The anti-transferrin receptor mouse monoclonal antibody (TransR, clone H68.4, Thermo Fisher Scientific, 1:1000) and the anti-alpha 1 Na+/K+-ATPase mouse monoclonal antibody (Na+/K+-ATPase α1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... recombinant GR-LBD-GST (A15668) and Nuclear Receptor Buffer F (PV4547) were all from Invitrogen.
-
bioRxiv - Immunology 2023Quote: ... Samples were then incubated with an Fc receptor binding inhibitor polyclonal antibody (Thermo Fisher Scientific), before staining with a surface antibody cocktail (Supplementary Table 1) ...
-
bioRxiv - Bioengineering 2021Quote: ... platelet-derived growth factor receptor A (PDGFRA) and type I collagen (COL1A1) (Thermo Fisher, Waltham, Massachusetts). Probe references ...
-
bioRxiv - Immunology 2022Quote: ... HEK 293T cells expressing ACE2 receptors were suspended using TrypLE Select Enzyme solution (Thermo Fisher Scientific) and immediately added to all wells (10,000 cells in 100 μl of growth medium per well) ...
-
bioRxiv - Immunology 2020Quote: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax ...
-
bioRxiv - Neuroscience 2021Quote: ... surface receptors were labeled with Pierce™ Premium Grade Sulfo NHS-SS-Biotin (Thermofisher, Waltham, USA) and purified using Streptavidin High Performance Spintrap™ (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: Receptor and chemokine baculovirus stocks were produced using the Bac-to-Bac Baculovirus Expression System (Invitrogen). Briefly ...
-
bioRxiv - Biophysics 2021Quote: ... western blots were performed to normalize for receptor quantity using monoclonal anti-HA antibody (Thermo Scientific). Reactions were started by adding 150μL partially purified receptor samples to 300μL of reaction mixture and incubating on ice for 1 hour ...
-
bioRxiv - Evolutionary Biology 2023Quote: The chemicals used for the deorphanization of receptors were obtained from Acros Organics (Morris, NJ, USA), Alfa Aesar (Ward Hill ...
-
bioRxiv - Neuroscience 2023Quote: Stably expressing 5-HT receptor Flp-In 293 T-Rex Tetracycline inducible system (Invitrogen, mycoplasma-free) were used for calcium flux assays ...
-
bioRxiv - Immunology 2023Quote: ... After treating the cells for 15 minutes (min) with Fc Receptor Binding Inhibitor Polyclonal Antibody (ThermoFisher), they were stained for 30 min at 4°C in the dark and washed twice again ...
-
TNFR1/p38αMAPK signaling in Nex+ supraspinal neurons regulates sex-specific chronic neuropathic painbioRxiv - Neuroscience 2023Quote: ... Membranes were probed with antibodies against: estrogen receptor β (Erβ, rabbit, 1:1000, Invitrogen PA1-311), tumor necrosis factor receptor 1 (TNFR1 ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then transiently transfected with receptor constructs using LipofectamineTM 2000 transfection system (ThermoFisher, cat# 11668019). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... cells were first incubated with an anti-CD16/CD32 Monoclonal Antibody to block FC receptors (Invitrogen). Cells were washed using PBS and incubated with LIVE/DEAD™ dye for 30 minutes at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... and IGF-1 receptor (Catalog number: AM51331, siRNA ID:110754) with Lipofectamine RNAiMax Transfection Reagent (Invitrogen), according to manufacturer’s established protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were pre-incubated with anti-Fc receptor antibody (Thermal Fisher Scientific, Cat. No. 14-9161-73) at 1:20 ratio to block Fc receptor before staining ...
-
bioRxiv - Microbiology 2020Quote: ... cells expressing the surface CD4 receptor were enriched using the Dynabeads CD4 cell isolation kit (Life Technologies). They were seeded to develop single cell-derived clones ...
-
bioRxiv - Immunology 2020Quote: ... at 1:10 or a rabbit anti-CD71 (transferrin receptor, endosomal marker) antibody (ThermoFisher Cat# PA5-83022) at 1:200 ...
-
bioRxiv - Microbiology 2021Quote: ... JCRB #1818) cells expressing the ACE2 or ACE and TMPRSS2 receptors respectively were cultured in DMEM (Gibco) supplemented with 5 % FBS (Fetal Bovine Serum) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the cell pellet was resuspended in Fc Receptor Binding Inhibitor Polyclonal Antibody (Invitrogen, 14-9161-73) diluted 1:100 in MACS buffer and incubated for 10 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were transfected with pCMV6 vectors bearing WT or mutant receptors using Lipofectamine 3000 transfection reagent (Invitrogen). Following 24 h culturing ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked by incubating cells with 1:50 anti- mouse CD16/CD32 (Fc block, Invitrogen) for 10 minutes at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The dilutions for the remaining antibodies are as follows: anti-Transferrin Receptor (ThermoFisher 13-6800, 1:1000), anti-FBXL5 (ThermoFisher PA5-113529 ...
-
bioRxiv - Bioengineering 2024Quote: ... the cells were pre-treated with Fc receptor binding inhibitor polyclonal antibody (eBioscience™, Thermo Fisher Scientific) for 30 min ...
-
bioRxiv - Bioengineering 2022Quote: ... and vascular endothelial growth factor receptor 2 (VEGFR-2, Catalog No. PA5-16487, Thermo Fisher Scientific, Waltham, MA). For sections being stained for a target antigen ...
-
bioRxiv - Immunology 2020Quote: ... PGT145 and PGT121 receptors (in a form of IgM) were grown in advanced Dulbecco’s modified Eagle’s medium (DMEM) (Gibco), supplemented with 10 % fetal calf serum ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant SARS-CoV-2 receptor binding domain was coated onto MaxiSorp 96-well plates (Thermo Scientific, Cat # 442404) at 200 ng/well at 4 °C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: The chemicals (S2 Table) used for the deorphanization of receptors were obtained from Acros Organics (Morris, NJ, USA), Alfa Aesar (Ward Hill ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibody dilutions were used: anti-folate receptor alpha 1 (1/300; Thermofisher, ref: PA5-101588) for nuclear fraction and anti-Sox2 (1/1000 ...
-
bioRxiv - Microbiology 2023Quote: ... Soluble EFNB2-Fc was constructed by cloning the receptor binding domain (a.a. I28 to G165) of EFNB2 into the NheI-BamHI sites of pcDNA3.1(+) (Invitrogen) with a N-terminal CD5 leader (MPMGSLQPLATLYLLGMLVASVLA ...
-
bioRxiv - Neuroscience 2024Quote: A synthetic DNA geneblock for the human PAC1R-null receptor sequence (PAC1R) was designed and ordered (Life Technologies) based on the NCBI protein data bank entry “NP_001109.2” ...
-
bioRxiv - Neuroscience 2020Quote: Short hairpin RNAs against the mu and delta receptors were designed using BLOCK-IT RNAi Designer software (Invitrogen, USA). The sequences of the 21-nt fragments complementary to the target mRNAs were GCTGCCCTTTCAGAGTGTTAA (Oprm1-1) ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNA encoding the short transcriptional variant of human DA D2 receptor with an N-terminal FLAG tag (SF-D2R-S) was inserted into mammalian expression vector pcDNA 3.1(+) (Invitrogen)62 ...
-
bioRxiv - Cell Biology 2020Quote: ... the surface receptors were labeled with 0.133 mg/ml of EZ-Link Sulfo-NHS-SS-Biotin (Thermo scientific, 21331) in PBS at 4 °C for 30 min ...
-
bioRxiv - Microbiology 2019Quote: ... and baby hamster kidney 21 cells expressing the MHV receptor (BHK-R) (32) were maintained at 37°C in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) supplemented with 10% serum (HyClone FetalClone II ...
-
bioRxiv - Neuroscience 2019Quote: Silencing lentiviral vectors were produced by co-transfecting HEK293T producing cells with lentiviral silencing plasmids GIPZ Human histamine H3 receptor shRNA (Clone V3LHS_638095 or Clone V3LHS_638091, Thermo Scientific) with packing plasmid psPAX2 and envelope coding plasmid pMD2.G (Addgene#12260 and #12259 ...
-
bioRxiv - Immunology 2022Quote: ... This master mix was added to premade 96 well TaqMan Array plates with chemokine/chemokine receptor primers (Thermo Fisher, Mouse Chemokines & Receptors Array plate ...
-
bioRxiv - Neuroscience 2019Quote: ... a cDNA encoding this receptor was cloned into the eukaryotic expression vector pcDNA 3.1(+) (Invitrogen; Cat. No. V790-20). To facilitate expression of the cloned receptor ...
-
bioRxiv - Immunology 2020Quote: ... pH 7.2) resuspended and incubated for 30 min in FACS buffer supplemented with Fc gamma receptor CD16/CD32 antibodies (ThermoFisher). Cells were then incubated with Alexa fluor 488-conjugated antibodies against F4/80 or rat IgG2a kappa isotype control ...
-
bioRxiv - Immunology 2020Quote: ... Reverse sICs were generated from these receptor-specific antibodies using goat-anti-mouse IgG F(ab)2 fragments (Invitrogen) in a 1:1 ratio ...
-
bioRxiv - Microbiology 2021Quote: Vero cells that stably express the canine receptor CD150 (Vero-cCD150) were grown in advanced Dulbecco’s modified Eagle medium (DMEM; Gibco) supplemented with 10% (V/V ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies were used: rabbit polyclonal anti-GPR10 receptor (1:200; PA5-29809 Thermo Scientific, Paisley, UK); rabbit polyclonal anti-NPFF2 receptor (1:200 ...
-
Analysis of RyR2 distribution in HEK293 cells and mouse cardiac myocytes using 3D MINFLUX microscopybioRxiv - Physiology 2023Quote: ... after the samples were blocked the cells were incubated with a ryanodine receptor monoclonal antibody (C333) (MA3-916, Invitrogen) overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Transferrin (loading control) was detected with mouse anti-human transferrin receptor antibody (1:500, Cat# 136800, Invitrogen, Waltham, MA). Protein samples (50 µg ...
-
bioRxiv - Neuroscience 2024Quote: HEK293 cells were seeded in 6-well plates and transfected with 0.25μg LgBiT-miniG (miniGs or miniGsq45) or LgBiT-β-arrestin240 and 0.25μg SmBiT-tagged receptor plasmids using 3µL Lipofectamine 2000 (Thermo Fisher). 24 hours after transfection ...
-
bioRxiv - Immunology 2022Quote: ... Dead cells were excluded using ThermoFisher LIVE/DEAD Fixable Aqua Dead Cell Stain and binding to Fc receptors was blocked using CD16/CD32 (clone 93, eBioscience/ThermoFisher). Absolute cell numbers were calculated using counting beads (123count eBeads ...
-
bioRxiv - Immunology 2019Quote: ... and cells stably expressing the receptors of interest were selected and cultured in the presence of 800 µg/ml G418 (Invitrogen). The human embryonic kidney cell line HEK293T (CRL-3216 ...