Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... All primer pairs for human samples were purchased from ThermoFisher Scientific (Supplementary Table 2).
-
bioRxiv - Physiology 2024Quote: ... and primer pairs (Invitrogen, USA) listed in Table 1 ...
-
bioRxiv - Microbiology 2020Quote: ... qPCR was performed with primer pairs listed in Table S6 and PowerSYBR Green (Applied Biosystems) and analyzed with QuantStudio 5 (Thermo Scientific).
-
bioRxiv - Bioengineering 2022Quote: ... TGF-beta-PE (1:100; ThermoFisher Scientific; 12-9821-82) using DAPI mounting medium ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time PCRs were performed on Applied Biosystems 7500 Fast Real-Time PCR System using the respective pair of primers designed with Primer Premier 6.0 and Maxima SYBR Green/ROX qPCR Master Mix (Thermo Scientific). PCR reactions were performed in four replicates ...
-
bioRxiv - Biophysics 2021Quote: ... either Transforming growth factor beta-1 (TGF-β1, Invitrogen, CA, USA) or epidermal growth factor (EGF ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-TGF Beta 1 (cat# 218981AP; Proteintech and cat# MA515065; Invitrogen), anti-Thrombospondin-4 (cat# AF2390 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-TGF Beta 1 (cat# 218981AP; Proteintech and cat# MA515065; Invitrogen), anti-Thrombospondin-4 (cat# AF2390 ...
-
bioRxiv - Cell Biology 2021Quote: ... recombinant human TGF-β1 (Life Technologies) was prepared in sterile water with 0.1% BSA following the manufacturer’s instructions and diluted in 50:50 media.
-
bioRxiv - Cancer Biology 2021Quote: ... FAM-labeled target primer and endogenous human ACTB control (beta actin) (Thermo Fisher Scientific) were mixed with master mix and template ...
-
bioRxiv - Immunology 2021Quote: ... Primer pairs Mm00442346_m1 and Mm00607939_s1 from Invitrogen were used to measure TLR2 and actin-B mRNAs respectively.
-
bioRxiv - Pathology 2024Quote: ... si-TGF-beta activated kinase 1 binding protein 1 (TAB1, Thermo Fisher Scientific) was transfected into hDPCs using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2023Quote: ... The recombinant human TGF-β1 (Invitrogen, MD, USA) was added at a final concentration of 1 ng/mL ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from 6 pairs of P21 mouse testes (3 pairs of wild type and 3 pairs of Mov10-/-) using TRIzol reagents (Thermo Fisher Scientific). 1 μg of total RNA from each sample was used to generate RNA-seq libraries using TruSeq Stranded mRNA Library Preparation Kit Set A (Cat ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers pairs were designed using Primer-BLAST (NCBI) and synthesized by Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... We manipulate concentration of transforming growth factor beta-1 (TGF-β, Invitrogen, CA, USA) between source and sink channels to develop chemical gradients in the center channel ...
-
bioRxiv - Genetics 2020Quote: ... and beta-3 Tubulin (ThermoFisher). Membranes were washed three times with TBST and then incubated with secondary antibodies for 1 hour at RT ...
-
bioRxiv - Microbiology 2021Quote: ... using bacterial-specific or 16s primer pairs (Invitrogen, MilliporeSigma).
-
bioRxiv - Plant Biology 2020Quote: ... A mix was performed according to the manufacturer’s instructions containing the specific primer pairs for each gene at 10 μM and SYBR Green/ROX qPCR Master Mix (Thermo Scientific). cDNA amplification reactions were performed in a final volume of 25 μl ...
-
bioRxiv - Physiology 2021Quote: ... PCR were then conducted using specific pairs of primers (Supplementary Table 1) and the Syber GreenER qPCR Supe Mix Universal (Invitrogen #11762), in the StepOne Plus equipment (Applied Biosystetems - Life Technologies) ...
-
bioRxiv - Immunology 2022Quote: ... Twenty-five nanograms of the resulting cDNA together with 500 nM of the primer pairs were submitted to qPCR using the PowerUP SYBR Green Mastermix (Thermo Fisher). The amplification reaction was monitored on the ViiA 7 Real-Time PCR System running on the QuantStudio Real Time PCR Software V1.3 (Thermo Fisher) ...
-
bioRxiv - Microbiology 2023Quote: ... Expression of csuAB pili gene expression by RT-qPCR was performed with cDNA using the qPCR primer pairs listed in Table S1 and following the protocol for Fast SYBR Green Master Mix (Applied Biosystems) using a StepOnePlus real-time PCR instrument (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primer pairs (Table 1) were purchased from Invitrogen (Carlsbad, USA) and extended over exon-intron boundaries ...
-
bioRxiv - Microbiology 2020Quote: ... Appropriate primer pairs and probes were selected using the Primer Express™ software (Thermo Fisher Scientific) and initial specificity was assessed by BLASTN searches against NCBI’s nucleotide database (55) ...
-
bioRxiv - Evolutionary Biology 2022Quote: Five primer pairs were designed by Ion AmpliSeq Designer (Thermofisher Scientific) using DQ459459.1 as a reference ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... with primer pairs and fluorescent beacons (TaqMan probe MGB, Applied Biosystems) (Table S2) ...
-
bioRxiv - Genomics 2023Quote: qPCR analysis of purified ChIP DNA was performed in technical duplicate for each primer pair using 2x SYBR mastermix (Applied Biosystems Cat#4385612) according to manufacturer’s instructions in a 6-10μl reaction using the primer sequences as below.
-
bioRxiv - Molecular Biology 2024Quote: ... The efficiency of digestion was assessed by qPCR using a primer pair that encompassed the BglII cut site with the Power SYBR PCR Kit (#4368702; Applied Biosystems, MA, USA) (Jin et al ...
-
bioRxiv - Immunology 2024Quote: Quantitative PCR (qPCR) primers (Invitrogen-ThermoFisher) were designed using Primer-BLAST (NCBI ...
-
bioRxiv - Immunology 2024Quote: Quantitative PCR (qPCR) primers (Invitrogen-ThermoFisher) were designed using Primer-BLAST (NCBI ...
-
bioRxiv - Immunology 2024Quote: ... qPCR primers were purchased from Thermofisher Scientific (GAPDH ...
-
bioRxiv - Molecular Biology 2020Quote: ... supernatants were diluted 4-fold and assayed with the Amyloid beta 40 Human ELISA Kit and either the Amyloid beta 42 Human ELISA Kit or the Amyloid beta 42 Human ELISA Kit Ultrasensitive (Invitrogen), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human Beta-2-Microglobulin (B2M) (ThermoFisher, Cat# 4333766T) served as an endogenous control for RNA input ...
-
bioRxiv - Cell Biology 2023Quote: ... Target mtDNA gene (Forward primer: 5′-CACCCAAGAACAGGGTTTGT-3′, Reverse primer: 5′-TGGCCATGGGTATGTTGTTAA-3′, Invitrogen custom primers) and reference 18S ribosomal RNA gene (Forward primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative PCR reactions were carried out with the indicated exonic primer pairs (Eurofins MWG Operon, 500 nM final concentration, Table 3) and the Power SYBR® Green PCR Master Mix (Applied Biosystems) and read in MicroAmp® Fast Optical 96-well plates (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2024Quote: ... was used to amplify specific circRNAs using its divergent primer pairs in QuantStudio 3/6 Real-Time PCR System (Thermo Fisher Scientific). The delta-CT method was used to check for the relative abundance of individual circular RNA molecules ...
-
bioRxiv - Neuroscience 2023Quote: ... and Odc (NM_012615.3) reference sequences were applied to design specific primer pairs (Primer Express 3.0 Software, Applied Biosystems): TCCGGGAGGATCCTAAGGAA (Kif4a fwd ...
-
bioRxiv - Developmental Biology 2022Quote: ... 10 ng/mL Human TGF-β 1 recombinant protein (Cat# PHG9204, Gibco) and 1 μg/mL L-Ascorbic acid 2-phosphate (Cat# A8960 ...
-
bioRxiv - Cell Biology 2023Quote: ... qPCR primers were ordered from Life Technologies and are 20-24 bp with a melting temperature of 58-62°C ...
-
bioRxiv - Cancer Biology 2022Quote: The detection of TGF-β in the cell culture media from SH-SY5Y and MDA-MB-231 cells treated with TEPA for 24h was performed according to the protocol suggested by Thermo Fisher (TGF-beta-1-Human-ELISA-Kit/BMS249-4).
-
bioRxiv - Systems Biology 2020Quote: ... QuantStudio 3 qPCR (Thermofisher) with KAPA Library Quantification Kit (Roche) ...
-
bioRxiv - Immunology 2021Quote: ... IFN beta human ELISA kit (Thermo Fisher Scientific; 414101) was used to quantify IFNB1 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... through PCR amplification using pair of primers 2 and 3 (Table S1) with a 2X Phusion Flash PCR Master Mix (Thermo Scientific, Cat. # F548S). Gibson Assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: 3 identical reactions were set up for each DNA and primer pair with 2X PowerUp SYBR Green Master Mix (Applied Biosystems cat #A25741) by using BioRad CFX96 thermocyclers ...
-
bioRxiv - Plant Biology 2024Quote: ... The primer pair was annealed followed by ligation using T4 ligase (Thermo Scientific) into pHEE401(pre-digested with bsa1 ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
bioRxiv - Neuroscience 2021Quote: ... Primers are reported in Table 3 and qPCR was performed with SYBR green PCR master mix (Applied Biosystems). Samples were excluded if technical replicates failed ...
-
bioRxiv - Plant Biology 2020Quote: ... The qPCR primers and probes were designed in Primer Express 2.3 (Applied Biosystems) using default parameters for TaqMan amplicons and were synthesised by IDT ...
-
bioRxiv - Neuroscience 2021Quote: ... qPCR was performed with Taqman primers (Life Technologies) on an ABI 7500 Real-Time PCR System ...
-
bioRxiv - Cancer Biology 2022Quote: ... Taqman reverse transcription primers and qPCR probes (ThermoFisher) used were as follows ...