Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... All primer pairs for human samples were purchased from ThermoFisher Scientific (Supplementary Table 2).
-
bioRxiv - Physiology 2024Quote: ... and primer pairs (Invitrogen, USA) listed in Table 1 ...
-
bioRxiv - Microbiology 2020Quote: ... qPCR was performed with primer pairs listed in Table S6 and PowerSYBR Green (Applied Biosystems) and analyzed with QuantStudio 5 (Thermo Scientific).
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time PCRs were performed on Applied Biosystems 7500 Fast Real-Time PCR System using the respective pair of primers designed with Primer Premier 6.0 and Maxima SYBR Green/ROX qPCR Master Mix (Thermo Scientific). PCR reactions were performed in four replicates ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-oestrogen receptor alpha (Thermo Fisher Scientific, clone SP1), anti-progesterone receptor (DAKO ...
-
bioRxiv - Immunology 2021Quote: ... Primer pairs Mm00442346_m1 and Mm00607939_s1 from Invitrogen were used to measure TLR2 and actin-B mRNAs respectively.
-
bioRxiv - Bioengineering 2021Quote: ... platelet-derived growth factor receptor A (PDGFRA) and type I collagen (COL1A1) (Thermo Fisher, Waltham, Massachusetts). Probe references ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers pairs were designed using Primer-BLAST (NCBI) and synthesized by Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... using bacterial-specific or 16s primer pairs (Invitrogen, MilliporeSigma).
-
bioRxiv - Plant Biology 2020Quote: ... A mix was performed according to the manufacturer’s instructions containing the specific primer pairs for each gene at 10 μM and SYBR Green/ROX qPCR Master Mix (Thermo Scientific). cDNA amplification reactions were performed in a final volume of 25 μl ...
-
bioRxiv - Physiology 2021Quote: ... PCR were then conducted using specific pairs of primers (Supplementary Table 1) and the Syber GreenER qPCR Supe Mix Universal (Invitrogen #11762), in the StepOne Plus equipment (Applied Biosystetems - Life Technologies) ...
-
bioRxiv - Immunology 2022Quote: ... Twenty-five nanograms of the resulting cDNA together with 500 nM of the primer pairs were submitted to qPCR using the PowerUP SYBR Green Mastermix (Thermo Fisher). The amplification reaction was monitored on the ViiA 7 Real-Time PCR System running on the QuantStudio Real Time PCR Software V1.3 (Thermo Fisher) ...
-
bioRxiv - Microbiology 2023Quote: ... Expression of csuAB pili gene expression by RT-qPCR was performed with cDNA using the qPCR primer pairs listed in Table S1 and following the protocol for Fast SYBR Green Master Mix (Applied Biosystems) using a StepOnePlus real-time PCR instrument (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primer pairs (Table 1) were purchased from Invitrogen (Carlsbad, USA) and extended over exon-intron boundaries ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-qPCR was performed for receptor cDNA using validated primers (S4 Table) and SYBR Green Power PCR Mix (Applied Biosystems, ThermoFisher) on an iQ5 real-time qPCR detection system (Bio-Rad) ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-qPCR was performed for receptor cDNA using validated primers (S4 Table) and SYBR Green Power PCR Mix (Applied Biosystems, ThermoFisher) on an iQ5 real-time qPCR detection system (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... Appropriate primer pairs and probes were selected using the Primer Express™ software (Thermo Fisher Scientific) and initial specificity was assessed by BLASTN searches against NCBI’s nucleotide database (55) ...
-
bioRxiv - Evolutionary Biology 2022Quote: Five primer pairs were designed by Ion AmpliSeq Designer (Thermofisher Scientific) using DQ459459.1 as a reference ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... with primer pairs and fluorescent beacons (TaqMan probe MGB, Applied Biosystems) (Table S2) ...
-
bioRxiv - Genomics 2023Quote: qPCR analysis of purified ChIP DNA was performed in technical duplicate for each primer pair using 2x SYBR mastermix (Applied Biosystems Cat#4385612) according to manufacturer’s instructions in a 6-10μl reaction using the primer sequences as below.
-
bioRxiv - Molecular Biology 2024Quote: ... The efficiency of digestion was assessed by qPCR using a primer pair that encompassed the BglII cut site with the Power SYBR PCR Kit (#4368702; Applied Biosystems, MA, USA) (Jin et al ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-PDGFRa (1:200, Invitrogen) and anti-vimentin (1:300 ...
-
bioRxiv - Immunology 2024Quote: Quantitative PCR (qPCR) primers (Invitrogen-ThermoFisher) were designed using Primer-BLAST (NCBI ...
-
bioRxiv - Immunology 2024Quote: Quantitative PCR (qPCR) primers (Invitrogen-ThermoFisher) were designed using Primer-BLAST (NCBI ...
-
bioRxiv - Immunology 2024Quote: ... qPCR primers were purchased from Thermofisher Scientific (GAPDH ...
-
bioRxiv - Neuroscience 2022Quote: ... Oligonucleotide primers for the GnRH receptor (Gnrhr) (Life Technologies, Table 1) gene were used to amplify gene-specific transcripts by quantitative PCR (qPCR) ...
-
bioRxiv - Neuroscience 2023Quote: ... and Odc (NM_012615.3) reference sequences were applied to design specific primer pairs (Primer Express 3.0 Software, Applied Biosystems): TCCGGGAGGATCCTAAGGAA (Kif4a fwd ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The human σ2 receptor was cloned into pcDNA3.1 (Invitrogen) mammalian expression vector with an amino-terminal protein C tag followed with a 3C protease cleavage site ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... the human σ2 receptor was cloned into pcDNA3.1 (Invitrogen) mammalian expression vector with an amino-terminal protein C tag followed with a 3C protease cleavage site and transfected into Expi293 cells (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... qPCR primers were ordered from Life Technologies and are 20-24 bp with a melting temperature of 58-62°C ...
-
bioRxiv - Neuroscience 2022Quote: ... and Pdgfra (Affymetrix, VB6-3197712-210). A probe targeting Actb (Affymetrix ...
-
bioRxiv - Plant Biology 2024Quote: ... The primer pair was annealed followed by ligation using T4 ligase (Thermo Scientific) into pHEE401(pre-digested with bsa1 ...
-
bioRxiv - Immunology 2021Quote: ... then incubated with human Fc receptor coupled to phycoerythrin (ThermoFisher). To set positive gates ...
-
bioRxiv - Neuroscience 2022Quote: The IL-6 Receptor (Soluble) Human ELISA Kit (Invitrogen; BMS214) was used as per the manufactures instructions to quantify soluble IL-6R expression in day 14 MGL and day 18 NPC vehicle/treated cell culture media ...
-
bioRxiv - Plant Biology 2020Quote: ... The qPCR primers and probes were designed in Primer Express 2.3 (Applied Biosystems) using default parameters for TaqMan amplicons and were synthesised by IDT ...
-
bioRxiv - Neuroscience 2021Quote: ... qPCR was performed with Taqman primers (Life Technologies) on an ABI 7500 Real-Time PCR System ...
-
bioRxiv - Cancer Biology 2022Quote: ... Taqman reverse transcription primers and qPCR probes (ThermoFisher) used were as follows ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-phospho-Pdgfra (Tyr754) (Thermo Fisher, 441008G), anti-Vim (R&D ...
-
bioRxiv - Cancer Biology 2024Quote: ... PDGFRA (1:1000, Thermo Fisher cat. 710169), PDGFRB (1:1000 ...
-
bioRxiv - Cell Biology 2024Quote: ... and PDGFRA-PE (1:50) (A15785, Invitrogen) for 30 minutes at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... The specific primer pairs used for qRT-PCR analyses were designed using the Primer Express version 2.0 software program (Applied Biosystems) (Table 2) ...
-
bioRxiv - Immunology 2021Quote: ... or Human TNF alpha ELISA Ready-SET-Go! (eBioscience/Invitrogen) and Nunc MaxiSorp 96-well plates (Thermo Fisher ...
-
bioRxiv - Immunology 2020Quote: ... or Human TNF alpha ELISA Ready-SET-Go! (eBioscience/Invitrogen) and Nunc MaxiSorp 96-well plates (Thermo Fisher ...
-
bioRxiv - Cell Biology 2020Quote: ... using TaqMan® Universal PCR Master Mix and predesigned primer pairs (Thermo Fisher Scientific) for rat Gapdh (Rn01775763_g1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... using TaqMan® Universal PCR Master Mix and predesigned primer pairs (Thermo Fisher Scientific) for rat Gapdh (Rn01775763_g1) ...
-
bioRxiv - Microbiology 2022Quote: ... TNF-alpha treatments were performed for 45 min using 25 ng/ml of human TNF-alpha (Thermo Fisher). Cells were permeabilized with 0.1% Triton X in phosphate-buffered saline (PBS ...
-
bioRxiv - Microbiology 2023Quote: ... This gene was amplified using primer pair C01/C02 (see supplementary Table S1 for all primer sequences) and subcloned into pJET1.2/blunt (Thermo Fisher Scientific). Primer pairs M01/M02 and M03/M04 were used with the Q5 site-directed mutagenesis kit (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibody dilutions were used: anti-folate receptor alpha 1 (1/300; Thermofisher, ref: PA5-101588) for nuclear fraction and anti-Sox2 (1/1000 ...
-
bioRxiv - Genomics 2020Quote: ... qPCR was performed using primers list below (SYBR, Invitrogen)
-
bioRxiv - Cancer Biology 2020Quote: ... Primers for RT-qPCR were purchased from Life Technologies: Arg1 (Mm00475988_m1 ...