Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for Human Immunodeficiency Virus Gag Protein HIV 1 Clade B IIIB since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... virus with Trypan Blue (Gibco, 1µl) was injected into the lateral ventricle using glass pipette (WPI) ...
-
bioRxiv - Immunology 2022Quote: ... Virus was diluted in OptiMem (ThermoFisher) and applied apically at a MOI 0.1 for two hours at 34,5°C with 5% CO2.
-
bioRxiv - Bioengineering 2023Quote: ... Varicella zoster virus solution (Fisher Scientific) was dropped onto a No.1 coverslip and dried on top ...
-
bioRxiv - Cell Biology 2023Quote: Cytotune OSKM Sendai virus (A16517, Invitrogen) and EmGFP reporter Sendai Virus (A16519 ...
-
bioRxiv - Neuroscience 2020Quote: Levels of total APOE protein were analysed by Human ELISA Kit from Invitrogen (Apolipoprotein E Human ELISA Kit). Levels of Aβ were analysed by ELISA (Human β Amyloid 42 ELISA Kit Wako high sensitive #298-64401 and Human β Amyloid 40 ELISA Kit Wako #298-64601 ...
-
bioRxiv - Biochemistry 2020Quote: ... supplemented with 2.5 μg / 500 mL EGF recombinant human protein (Gibco) and 1% penicillin and streptomycin (Wisent ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 ng/mL human EGF recombinant protein (Life Technologies, Cat: PHG0311), and 100 IU/mL P/S ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... VEGF ligand (recombinant human protein) was ordered from ThermoFisher (CAT: #PHC9391).
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/uL human IL-6 recombinant protein (ThermoFisher PHC0066).
-
bioRxiv - Bioengineering 2024Quote: ... 5250 ng/mL human recombinant IL-6 protein (Invitrogen; Waltham, MA) was added to the experimental group and an equal volume of 1X PBS was added to the control group ...
-
bioRxiv - Immunology 2021Quote: ... qPCR was performed using TaqMan Fast virus 1 Step PCR Master Mix (Life Technologies), standard curve was drawn with 2019_nCOV_N Positive control (IDT) ...
-
bioRxiv - Immunology 2022Quote: ... amplified using the TaqMan Fast Virus 1-Step Master Mix qRT-PCR kit (Invitrogen) on a LightCycler 480 or LC96 instrument (Roche) ...
-
bioRxiv - Microbiology 2019Quote: ... probes and TaqMan Fast Virus 1-Step Master Mix (Applied Biosystems, Foster City, CA). We used pre-combined probe and primers (500 nM primers and 250 nM probe ...
-
bioRxiv - Microbiology 2021Quote: ... while 4x Taqman Fast Virus 1-Step Master Mix (Life Technologies, Carlsbad, CA, USA) was used for RNA enteric viruses ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... RNA was quantified using qRT-PCR TaqMan Fast Virus 1-step assay (Applied Biosystems). SARS-CoV-2 specific primers and probes from the 2019-nCoV RUO Assay kit (Integrated DNA Technologies ...
-
bioRxiv - Immunology 2022Quote: ... PCR reactions were conducted with TaqMan Fast Virus 1-Step Master Mix (Applied Biosystems), forward primer in the 5’ leader region and gene-specific probes and reverse primers as follows:
-
bioRxiv - Microbiology 2022Quote: ... using TaqMan Fast Virus 1-Step Master Mix (Cat. n° 4444434, Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... were quantified by RT-qPCR using TaqMan Fast Virus 1-Step Master Mix (ThermoFisher) and specific primers and probes (Supplementary Table 3) ...
-
bioRxiv - Immunology 2019Quote: ... and inoculated with virus at the optimal MOI of 100:1 in DMEM (Gibco). After 1.5 h ...
-
bioRxiv - Zoology 2020Quote: ... 6.25μL of 4X RT-Buffer (TaqMan Fast Virus 1-Step Master Mix, ThermoFisher Scientific), 600nM of the forward primer (RdRp_SARSr-F) ...
-
bioRxiv - Microbiology 2021Quote: ... Eluted RNA was coupled with TaqMan Fast Virus 1-step Master Mix (Applied Biosystems) and nCOV_N1 primers/probe (IDT ...
-
bioRxiv - Immunology 2021Quote: ... PCR reactions were conducted with TaqMan Fast Virus 1-Step Master Mix (Applied Biosystems), forward primer in the 5’ leader region ...
-
bioRxiv - Immunology 2022Quote: ... mouse anti-Influenza A Virus M1 (1:1,000; clone: GA2B; Cat#: MA1-80736; Invitrogen), mouse anti-Influenza A virus M2 (1:1,000 ...
-
bioRxiv - Bioengineering 2022Quote: ... consisting of 5 μL TaqMan Fast Virus 1-Step Master Mix (cat# 4444432, Thermofisher), 1.2 μL forward primer (0.6 μm) ...
-
bioRxiv - Immunology 2022Quote: ... mouse anti-Influenza A virus M2 (1:1,000; clone: 14C2; Cat#: MA1-082; Invitrogen), mouse anti-GAPDH (1:1,000 ...
-
bioRxiv - Immunology 2023Quote: ... Concentrated virus was then incubated using 1:2000 DiD-Cell labelling solution (ThermoFisher V22887) for 20 mins at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... Cellular RNA was mixed with TaqMan Fast Virus 1-step Master Mix (Applied Biosystems), 10 mM forward and reverse primers and 2 mM probe ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5 µl of template and TaqMan Fast Virus 1-step mastermix (Applied Biosystems). Primer sequences and concentrations and thermal cycling conditions for SARS-CoV-2 nucleocapsid 1 gene were as previously described (13) ...
-
bioRxiv - Immunology 2023Quote: ... PCR reactions were conducted with TaqMan Fast Virus 1-Step Master Mix (Applied Biosystems), forward primer in the 5’ leader region and gene-specific probes and reverse primers as follows ...
-
bioRxiv - Immunology 2023Quote: ... PCR reactions were conducted with TaqMan Fast Virus 1-Step Master Mix (Applied Biosystems), forward primer in the 5’ leader region and N gene-specific probe and reverse primer as previously described47:
-
bioRxiv - Cancer Biology 2021Quote: Human adenoid primary B cells were stained with CellTrace Violet according to the manufacturer’s instructions (Thermo Fisher Scientific). Proliferation of CD19+ B cells was monitored by flow cytometry using BD Fortessa and the data were analyzed using the FlowJo software (Version 10.5.3).
-
bioRxiv - Molecular Biology 2020Quote: ... SIV gag RNA was quantified by qRT-PCR using the TaqMan RNA-to-Ct 1-Step Kit (Thermo Fisher Scientific, MA; Cat# 4392938) and Applied Biosystems QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... HIV cDNA was amplified with TaqMan gene expression master mix (Applied Biosystems, 4369016), J1 FWD (late RT F)— ACAAGCTAGTACCAGTTGAGCCAGATAAG ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR analysis of intracellular HIV-1 RNA was performed using PowerUp SYBR Green Master Mix (Applied Biosystems, Foster City, CA). Primer sequences used for the detection of HIV-1-RNA and β-actin gene are listed in table S2 ...
-
bioRxiv - Microbiology 2021Quote: ... HIV-1-infected primary CD4+ T cells were stained with AquaVivid viability dye and cell proliferation dye eFluor670 (Thermo Fisher Scientific) and used as target cells ...
-
bioRxiv - Microbiology 2020Quote: ... to quantify total and integrated HIV-1 DNA was performed as described previously (48) using TaqMan™ Universal PCR Master Mix (ThermoFisher). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... Drug resistance testing spanning protease (PR) and reverse transcriptase (RT) had been performed using Sanger Sequencing with the Applied Biosystems HIV-1 Genotyping Kit (ThermoFisher Scientific). We obtained the most recently generated residual nested-PCR amplicons tested and since amplicon volumes were limited ...
-
bioRxiv - Microbiology 2021Quote: ... Ten-fold serial dilutions (1×10−1 to 1×10−6) of virus stocks were prepared in MEM (supplemented with 25 mM HEPES (Gibco), 2mM L-Glutamine (Gibco) ...
-
bioRxiv - Plant Biology 2022Quote: ... the induction media was removed by centrifugation and proteins were extracted by the resuspension of bacteria in B-PER™ Bacterial Protein Extraction Reagent (ThermoFisher Scientific) with 0.8 U/mL DNase I (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2019Quote: ... 1 ml of B-27 Supplement (GIBCO, ThermoFisher Cat. #17504044); 1 ml of Penicillin-Streptomycin solution (GIBCO ...
-
bioRxiv - Neuroscience 2019Quote: ... 1 ml of B-27 Supplement (GIBCO, ThermoFisher Cat. #17504044); 1 ml of Penicillin-Streptomycin solution (GIBCO ...
-
bioRxiv - Bioengineering 2020Quote: ... 1% penicillin-streptomycin-amphotericin B (ThermoFisher Scientific, Waltham, MA; 15240062), 1% Glutamax (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% penicillin-streptomycin and 1x B-27 Plus (Gibco, A3582801) for 4 h before a complete media change to maintenance medium (plating medium devoid of serum).
-
bioRxiv - Cell Biology 2020Quote: ... 1:50 (v/v) B-27 supplement (Thermo Fisher Scientific), 0,5 % (w/v ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1× B-27 Supplement Minus Vitamin A (Thermo Fisher Scientific), 2 mM GlutaMAX™ (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1% Amphotericin B (fungizone®) (Thermo Fisher Scientific, UK).
-
bioRxiv - Cell Biology 2022Quote: ... and 1% Amphotericin B (fungizone®) (Thermo Fisher Scientific, UK) and 1% GlutaMAX™ (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... B-27™ supplement minus insulin (1×, Thermo Fisher Scientific) and CHIR99021 (8 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... supplemented with 1× B-27 Plus supplement (Thermo Fisher Scientific), 0.5% penicillin/streptomycin ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1× B-27™ Plus Supplement (ThermoFisher Scientific, A3582801). Unless noted otherwise ...