Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for Human High Sensitive Leucine Rich Alpha 2 Glycoprotein 1 LRG1 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... cell membranes were loaded with the voltage-sensitive dye D-2-ANEPEQ (JPW1114, 0.2 mg/mL, Thermo Fisher Scientific) for 30 minutes using a first patch clamp recording and then re-patched a second time with dye free solution ...
-
bioRxiv - Molecular Biology 2022Quote: Membrane order was assessed using the polarity-sensitive membrane probe Laurdan (6-Dodecanoyl-2-Dimethylaminonaphthalene) (Thermo Fisher Scientific, D250)20 ...
-
bioRxiv - Neuroscience 2023Quote: ... neuronal membranes were loaded with the voltage-sensitive dye D-2-ANEPEQ (JPW1114, 0.2 mg/mL, Thermo Fisher Scientific) for 30 minutes using a first patch clamp recording and then re-patched a second time with dye free solution ...
-
bioRxiv - Neuroscience 2023Quote: ... cell membranes were loaded with the voltage-sensitive dye D-2-ANEPEQ (JPW1114, 0.2 mg/mL, Thermo Fisher Scientific) for 30 minutes using a first patch clamp recording and then re-patched a second time with dye free solution ...
-
bioRxiv - Biochemistry 2021Quote: ... these gels were then stained with Periodic acid-Schiff stain using the Pierce Glycoprotein Staining Kit (Thermo Scientific) and Coomassie stained with InstantBlue Protein Stain (Expedeon).
-
bioRxiv - Developmental Biology 2022Quote: ... the samples were mounted on a cover slide and stained using Pierce™ Glycoprotein Saining Kit (Thermo Scientific), with PBS buffer wash to prevent drying ...
-
bioRxiv - Neuroscience 2019Quote: ... The fluorescent calcium sensitive dye Oregon Green 488 BAPTA-1 (OGB-1, Invitrogen, Life Technologies, Carlsbad, CA, USA) was prepared as described previously52 ...
-
bioRxiv - Neuroscience 2019Quote: ... The fluorescent calcium sensitive dye Oregon Green 488 BAPTA-1 (OGB-1, Invitrogen, Life Technologies, Carlsbad, CA, USA) was prepared as described previously52 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mouse anti-Alpha-Smooth Muscle Actin (ACTA2) (ThermoFisher; 1:100), Rabbit anti-PDGFR beta (Abcam ...
-
bioRxiv - Genomics 2019Quote: ... rabbit α-CaMKII alpha (#PA514315, Thermo Fisher Scientific, 1:50), chicken α-GFAP (#ab4674 ...
-
bioRxiv - Cell Biology 2019Quote: ... alpha-tubulin DM1a (1:1000 for IF & WB) (ThermoFisher #62204); rabbit monoclonal anti-p60 EPR5071 ...
-
bioRxiv - Physiology 2023Quote: ... alpha X (CD11c; M1, pro-inflammatory macrophages; Invitrogen; 1:300), and mannose receptor (CD206 ...
-
bioRxiv - Bioengineering 2023Quote: ... anti-mouse alpha-tubulin (1:100; A11126, ThermoFisher, MA, USA); anti-rabbit vinculin (1:50 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 25 units/mL penicillin/streptomycin and 2 mM L-glutamine in alpha MEM (Gibco) for 2 weeks under hypoxia (5% oxygen ...
-
bioRxiv - Cell Biology 2021Quote: ... a rat monoclonal antibody against yeast alpha-tubulin (clone YL1/2) from Thermo Fisher Scientific (Pittsburgh ...
-
bioRxiv - Bioengineering 2020Quote: ... Fifty microliter clots were formed from purified fibrinogen using 0.25 U/mL human alpha-thrombin (Fisher Scientific), 2 mg/mL fibrinogen (Enzyme Research Laboratories) ...
-
Nanoscale molecular architecture controls calcium diffusion and ER replenishment in dendritic spinesbioRxiv - Neuroscience 2021Quote: Cultures were incubated for 1 h in Fluo-2 (high affinity) AM (2 μm; Invitrogen, Carlsbad, CA, USA) containing recording medium containing (in mM ...
-
bioRxiv - Microbiology 2020Quote: ... high sensitivity kit (ThermoFisher). A standard curve was generated by mixing 10 μL of the eight DNA standards provided (0 to 10 ng/μL ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA samples were prepared from freeze-dried cells (CHRIST Alpha 1‐2 LDplus lyophilizer, Osterode, Germany) derived from untreated and farnesol-treated cultures using TRISOL (Invitrogen, Austria) reagent ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were incubated with an alpha tubulin monoclonal antibody conjugated to Alexa Fluor 488 (B-5-1-2, Invitrogen, Carlsbad, CA) at 2 μg/mL in 1% BSA in PBS for 1 hour ...
-
bioRxiv - Developmental Biology 2022Quote: ... 30 µg of pCAGGS SARS CoV-2 S Glycoprotein expression vector DNA (NR52310, BEI, USA) in a total of 10 mL of Opti-MEM media (Invitrogen, USA). One day after transfection the media was removed ...
-
bioRxiv - Immunology 2023Quote: ... HIV reporter pseudoviruses expressing SARS-CoV-2 S glycoprotein and carrying the luciferase gene were produced in Expi293F cells (ThermoFisher Scientific) by co-transfection of the pNL4-3 ...
-
bioRxiv - Plant Biology 2020Quote: ... Cytosine methylation on target loci was assessed by Methylation-Sensitive Restriction Enzyme qPCR (MSRE-qPCR) (Hashimoto et al., 2007) using the methylation sensitive endonucleases HpaII and SalI (Thermo Fisher Scientific). Full information related to target loci identity and location of the target CpG sites evaluated is reported in Table S2 ...
-
bioRxiv - Cancer Biology 2019Quote: Of the 270 HGSOC subjects classified as sensitive or resistant to chemotherapy, 238 (138 sensitive, 100 resistant) had microarray expression data available (Affymetrix ht_hg_u133a chip) in the GDC portal ...
-
bioRxiv - Genomics 2020Quote: ... transferred to serum-rich medium (complete medium: DMEM/F12 glutaMAX (Gibco), 1% N2 supplement (Gemini Bio) ...
-
bioRxiv - Genomics 2023Quote: ... coated dishes in N2 medium (high-glucose DMEM, 1% N-2, 2% B-27 and 1% penicillin/streptomycin, from Thermo Fisher Scientific) at a density of 2×105 cells/cm2 ...
-
bioRxiv - Neuroscience 2022Quote: ... and calcium-sensitive dye Fluo-4F (250 μM) (Invitrogen) were added to the intracellular solution to monitor calcium transients ...
-
bioRxiv - Plant Biology 2023Quote: ... exposed to light-sensitive film (CL-Xposure; Thermo Fisher) for a few seconds to several minutes ...
-
bioRxiv - Physiology 2023Quote: ... loaded with the calcium-sensitive fluorophore Fluo-3 (ThermoFisher) for 1.5 h at 37 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 μL of membrane-sensitive dye (Fluovolt dye, Invitrogen) was mixed with 100 μl of 100× Pluronic™ surfactant polyols (PowerLoad Concentrate ...
-
bioRxiv - Genetics 2020Quote: ... 1-2 ug total RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific, #4368814). Real-time PCR was performed using specific primers for ACTN2 (GCTGAAGAAATTGTTGATGG ...
-
bioRxiv - Cell Biology 2019Quote: ... ELISAs were performed using FBLN5 (Fibulin-5) Human ELISA Kit from Fine Test (EH0772) and Thrombospondin 1 (TSP1) Human ELISA Kit from Invitrogen (BMS2100), following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2024Quote: ... IL-2 was measured by human IL-2 ELISA (Invitrogen) using the manufacturer instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were loaded with 1 µM calcium-sensitive fluorescent dye (Fluo-4 AM; Invitrogen, Life Technologies) diluted in fresh Cl- buffer (154.6 mM ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were loaded with 1 µM calcium-sensitive fluorescent dye (Fluo-4 AM; Invitrogen, Life Technologies) diluted in fresh Cl- buffer (154.6 mM ...
-
bioRxiv - Microbiology 2020Quote: ... in MEM-alpha (Gibco) with 20% FBS (Hyclone) ...
-
bioRxiv - Bioengineering 2023Quote: ... in alpha-MEM (Gibco). MSCs were cultured to 80% confluence following standard protocols (65) ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.03% (w/v) L-glutamine (Alpha Caesar #A14201) 2% (w/v) sucrose (Fisher Scientific #10634932), and 100 μM acetosyringone ...
-
bioRxiv - Microbiology 2023Quote: The RBDs of G614, Alpha, Beta, and Omicron (BA.1, BA.2, BA.4/5) variants were ordered as GeneString from GeneArt (Thermo Fisher Scientific). All sequences of the RBD (aa 319-541 in GenBank ...
-
bioRxiv - Developmental Biology 2021Quote: ... alpha-smooth muscle actin (1:500; Thermo Fisher Scientific, MA1-06110), ACE2 (1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... Anti IL-1 alpha (Thermo Fisher Scientific; Cat.# 11-7118-81).
-
bioRxiv - Cancer Biology 2022Quote: ... PE-Cyanine7_TNF alpha (1:100, Thermo Fisher Scientific, #25-7423-82)
-
bioRxiv - Cancer Biology 2020Quote: ... overnight at 4 °C and alpha-Tubulin (Invitrogen, 11224-1-AP) for 1-2 hours at room temperature ...
-
bioRxiv - Pathology 2019Quote: ... anti-alpha smooth muscle actin antibody (1:200, 180186; Life technologies), anti-CD31 (1:100 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1/500 diluted alpha-synuclein monoclonal antibody (Syn 211, Thermofisher, AHB0261) prepared in intracellular staining buffer (ISB ...
-
bioRxiv - Cell Biology 2022Quote: ... alpha-tubulin (MS-581, Thermo Fisher; 1:10,000 for western blotting) Lamin B1 (ab16048 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Alpha Amylase (rabbit polyclonal, 1:200; PA5-51078, Thermo Fisher Scientific), Insulin (rabbit polyclonal ...
-
bioRxiv - Developmental Biology 2024Quote: ... Alpha-bungarotoxin (BTX) conjugated with Alexa Fluor 647 (1:500, Invitrogen) was used in order to visualize nicotinic acetylcholine receptor densities ...
-
bioRxiv - Immunology 2021Quote: ... 1% PenStrep were transfected with the plasmid encoding for the corresponding S glycoprotein using lipofectamine 2000 (Life Technologies) following manufacturer’s indications ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA (2 μg) was reverse transcribed using a high-capacity cDNA reverse transcription kit (Applied Biosystems). Primers (5’ to 3’ ...