Labshake search
Citations for Thermo Fisher :
1 - 50 of 5122 citations for Human Death Receptors since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The human σ2 receptor was cloned into pcDNA3.1 (Invitrogen) mammalian expression vector with an amino-terminal protein C tag followed with a 3C protease cleavage site ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the human σ2 receptor was cloned into pcDNA3.1 (Invitrogen) mammalian expression vector with an amino-terminal protein C tag followed with a 3C protease cleavage site and transfected into Expi293 cells (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... then incubated with human Fc receptor coupled to phycoerythrin (ThermoFisher). To set positive gates ...
-
bioRxiv - Molecular Biology 2019Quote: ... Mouse anti-human transferrin receptor antibody was from Life Technologies. Secondary IRDye-labeled goat anti-mouse and anti-rabbit IgG antibodies were from LI-COR Biosciences ...
-
bioRxiv - Neuroscience 2022Quote: The IL-6 Receptor (Soluble) Human ELISA Kit (Invitrogen; BMS214) was used as per the manufactures instructions to quantify soluble IL-6R expression in day 14 MGL and day 18 NPC vehicle/treated cell culture media ...
-
bioRxiv - Neuroscience 2023Quote: The IL-6 Receptor (Soluble) Human ELISA Kit (Invitrogen; BMS214) was used to quantify soluble IL-6Ra expression in cell culture media ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Human V1A Receptor-CHO cell line (CHO -V1a) was cultured in Ham’s F12 (Life Technologies) supplemented with 10% fetal bovine serum (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cells were stained with human FITC conjugated transferrin receptor (CD71; ThermoFisher: 11-0719-42) and human FITC conjugated glycophorin A (CD235a ...
-
bioRxiv - Cancer Biology 2020Quote: ... SYTOX TM green death dye (Molecular Probes) was added at the time of ATRi addition in some experiments and monitored using fluorescence image acquisition ...
-
bioRxiv - Immunology 2020Quote: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax ...
-
bioRxiv - Genetics 2023Quote: ... androgen receptor (Invitrogen), PTK2 (Invitrogen) ...
-
bioRxiv - Neuroscience 2024Quote: A synthetic DNA geneblock for the human PAC1R-null receptor sequence (PAC1R) was designed and ordered (Life Technologies) based on the NCBI protein data bank entry “NP_001109.2” ...
-
bioRxiv - Immunology 2022Quote: ... as a death marker and anti-CD28 antibody (ThermoFisher, Waltham ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Cell death was determined by positive Sytox Green (Invitrogen) staining ...
-
bioRxiv - Cancer Biology 2024Quote: ... POPO™-1 Iodide death marker (Thermo Fisher Scientific) was added to all the wells of the plate at the final concentration of 0.2μM followed by 24-hour time-lapse microscopy using the OperaPhenix microscope (PerkinElmer) ...
-
bioRxiv - Neuroscience 2019Quote: Silencing lentiviral vectors were produced by co-transfecting HEK293T producing cells with lentiviral silencing plasmids GIPZ Human histamine H3 receptor shRNA (Clone V3LHS_638095 or Clone V3LHS_638091, Thermo Scientific) with packing plasmid psPAX2 and envelope coding plasmid pMD2.G (Addgene#12260 and #12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... Transferrin (loading control) was detected with mouse anti-human transferrin receptor antibody (1:500, Cat# 136800, Invitrogen, Waltham, MA). Protein samples (50 µg ...
-
bioRxiv - Neuroscience 2021Quote: ... and anti-transferrin receptor (Invitrogen). For the screening of compounds with the potential to rescue GlyT2 defective phenotypes the following chemicals were used ...
-
bioRxiv - Cell Biology 2023Quote: ... Transferrin receptor (Invitrogen, 13-6890), NHE5 (PA5-37222) ...
-
bioRxiv - Cell Biology 2020Quote: Parent CHO-K1 and CHO-K1 cells stably expressing extracellular ACP-tagged human insulin receptors were maintained at 37°C with 5% CO2 in HAM’s F-12 medium (Thermo Fisher) supplemented 10% fetal bovine serum (FBS) ...
-
bioRxiv - Immunology 2021Quote: The COVID-19 receptor-binding domain (RBD) and the N-terminal peptidase domain of human ACE2 were expressed using HEK293F cells (Invitrogen). The COVID-19 RBD (residues Arg319-Phe541 ...
-
bioRxiv - Immunology 2021Quote: ... or LIVE/DEAD fixable yellow death stain kit (Molecular Probes) were used ...
-
bioRxiv - Developmental Biology 2022Quote: ... together with the cell death dye Sytox blue (Life technologies), all detected by the violet laser as one dump channel ...
-
bioRxiv - Immunology 2020Quote: ... Neuronal cell death was examined using SYTOXgreen (Thermo Fisher Scientific) at 24 h after adding recombinant proteins or culture supernatants.
-
bioRxiv - Cancer Biology 2023Quote: ... Cell death was measured using SYTOX green (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2024Quote: ... For cell death analysis sytox orange (1:1000, Thermo Fisher) was added to the medium on top of the polymerized gel ...
-
bioRxiv - Neuroscience 2023Quote: ... Fetal brains were evaluated by Western blot (corticotropin releasing factor receptor 1 [CRFR1]; glucocorticoid receptor [GR], interleukin [IL]-6 receptor [IL-6R]; IL-17A and β-actin, Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Cell Biology 2021Quote: The expression cassette consisting of a Kozak sequence followed by the coding sequence for human diphtheria toxin receptor (hDTR; UniProt Q53H93) was codon-usage optimized for expression in mice and synthesized (Thermo Fisher Scientific/GeneArt ...
-
bioRxiv - Cell Biology 2021Quote: ... gene expression was analysed using the TaqMan™ Array Human Cardiomyocyte Differentiation by BMP Receptors (Thermo Fisher Scientific, Waltham, MA). Methods are detailed in the online Supplementary material.
-
bioRxiv - Molecular Biology 2020Quote: ... and Transferrin Receptor (1:1,000; Invitrogen). Proteins were detected with HRP-conjugated secondary antibodies (1:10,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti‐transferrin receptor (1:500; Invitrogen), anti‐α‐fodrin (1:5000 ...
-
bioRxiv - Neuroscience 2022Quote: Cell death was detected using Propidium iodide (PI, Thermo Fisher Scientific) or SYTOX™ Green (SYTOX ...
-
bioRxiv - Biophysics 2023Quote: ... or 3 µM SytoxBlue Cell Death stain (Thermos Fisher Scientific, S34857). Pyroptosis kinetics measurements were performed by acquiring images before pyroptosis induction and afterwards with intervals of 15 min at a Spinning disk confocal microscope (CellVoyagerTM CQ1 Benchtop High ...
-
bioRxiv - Neuroscience 2024Quote: Cell death was detected using Propidium iodide (PI, Thermo Fisher Scientific) or SYTOX™ Green (SYTOX ...
-
bioRxiv - Microbiology 2021Quote: ... Vero-hSLAMF1 cells [52] stably express the human measles receptor SLAMF1 and were cultured in Dulbecco modified Eagle medium (DMEM; Thermo Fisher Scientific) containing 5% newborn calf serum (NCS ...
-
bioRxiv - Cancer Biology 2019Quote: Cell death was documented using an AnnexinV staining kit (V13241, Life Technologies) as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell death was also assessed by SYTOX Green (#S7020; Thermo Fisher Scientific), a membrane-impermeable DNA dye that enters dead cells ...
-
bioRxiv - Cell Biology 2022Quote: ... and cell death with 50 μg ml−1 Propidium Iodide (Thermo Scientific) in non-infected and Mabs-infected organoids ...
-
bioRxiv - Neuroscience 2024Quote: Cell death was detected using SYTOX™ Green(SYTOX, Thermo Fisher Scientific) which is excluded from viable cells but exhibits red fluorescence following a loss of membrane integrity and Hoechst 33342 (Hoechst ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell death was measured by Sytox Green inclusion (Thermo Fisher Scientific #S7020). Images were taken every hour with a 10x objective ...
-
bioRxiv - Immunology 2022Quote: ... and FcR (Fc receptor) true block (Invitrogen) for 12 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... and laminin receptors (Thermo Fisher Scientific, 34094). Protein signals were acquired with a Fusion FX imaging system (Vilber).
-
bioRxiv - Immunology 2023Quote: Cells were stained for viability (Supplementary table 1 and Supplementary table 4) and blocked for CD16/32 with anti-human FC Receptor binding inhibitor (ThermoFisher Scientific, 14-9161-73) in PBS for 15 minutes at room temperature (Spn ...
-
bioRxiv - Microbiology 2021Quote: For analysis of cell death during infection SYTOX Green assay (Thermo Fisher Scientific) was performed which measures membrane permeability (Grootjans et al. ...
-
bioRxiv - Cancer Biology 2022Quote: For cell death measurements using Propidium iodide (25 μg/mL) (Invitrogen, Cat# P1304MP), 2×105 cells were labeled with Propidium iodide in 1 mL of warm complete medium for 15 minutes in a tissue culture incubator (37°C ...
-
bioRxiv - Neuroscience 2020Quote: Cell death was determined using the ReadyProbes™ cell viability imaging kit (Invitrogen). NucBlue live reagent and NucGreen dead reagent stains were diluted into media (2 drops per mL blue ...
-
bioRxiv - Cancer Biology 2019Quote: ... and apoptotic cell death was assessed by using a TUNEL assay Kit (InVitrogen), following the manufacturer’s suggested protocols.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... death marker PI and apoptosis marker Annexin V (all from Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2020Quote: ... Transferrin receptor (clone H68.4, Invitrogen 13-6890, WB), β-actin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2019Quote: ... Receptors were coated down onto ELISA plates (Nunc) in carbonate buffer pH 9 (Sigma-Aldrich ...