Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Human Cholecystokinin A Receptor CCKAR Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... the human CCKAR gene was cloned into a modified pFastBac1 vector (Invitrogen), which contains an expression cassette with a hemagglutinin (HA ...
-
bioRxiv - Biophysics 2021Quote: ... The full-length CCKAR cDNA was cloned into a modified pFastBac vector (Invitrogen) containing a hemagglutinin (HA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The human σ2 receptor was cloned into pcDNA3.1 (Invitrogen) mammalian expression vector with an amino-terminal protein C tag followed with a 3C protease cleavage site ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the human σ2 receptor was cloned into pcDNA3.1 (Invitrogen) mammalian expression vector with an amino-terminal protein C tag followed with a 3C protease cleavage site and transfected into Expi293 cells (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... then incubated with human Fc receptor coupled to phycoerythrin (ThermoFisher). To set positive gates ...
-
bioRxiv - Molecular Biology 2019Quote: ... Mouse anti-human transferrin receptor antibody was from Life Technologies. Secondary IRDye-labeled goat anti-mouse and anti-rabbit IgG antibodies were from LI-COR Biosciences ...
-
bioRxiv - Neuroscience 2022Quote: The IL-6 Receptor (Soluble) Human ELISA Kit (Invitrogen; BMS214) was used as per the manufactures instructions to quantify soluble IL-6R expression in day 14 MGL and day 18 NPC vehicle/treated cell culture media ...
-
bioRxiv - Neuroscience 2023Quote: The IL-6 Receptor (Soluble) Human ELISA Kit (Invitrogen; BMS214) was used to quantify soluble IL-6Ra expression in cell culture media ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Human V1A Receptor-CHO cell line (CHO -V1a) was cultured in Ham’s F12 (Life Technologies) supplemented with 10% fetal bovine serum (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cells were stained with human FITC conjugated transferrin receptor (CD71; ThermoFisher: 11-0719-42) and human FITC conjugated glycophorin A (CD235a ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membrane fraction’s protein content was normalized by using anti-transferrin receptor antibody (Invitrogen).
-
bioRxiv - Immunology 2020Quote: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax ...
-
bioRxiv - Genetics 2023Quote: ... androgen receptor (Invitrogen), PTK2 (Invitrogen) ...
-
bioRxiv - Physiology 2019Quote: ... Protein homogenates were analyzed for abundance of phosphorylated(Tyr972)-insulin receptor (Invitrogen: 44-800G), insulin receptor-β (Cell Signaling ...
-
bioRxiv - Molecular Biology 2022Quote: In vitro sumoylation reactions were performed on protein array slides with more than 9000 human proteins spotted (ProtoArray® Human Protein Microarray v5.0, Invitrogen). The reaction was performed by the technical service of Invitrogen with our purified enzymes ...
-
bioRxiv - Systems Biology 2024Quote: ... EGF Recombinant Human Protein (Gibco #PHG0313), FGF Basic (aa 10 155 ...
-
bioRxiv - Neuroscience 2024Quote: A synthetic DNA geneblock for the human PAC1R-null receptor sequence (PAC1R) was designed and ordered (Life Technologies) based on the NCBI protein data bank entry “NP_001109.2” ...
-
bioRxiv - Cancer Biology 2019Quote: Human protein arrays (ProtoArrays V5.0, Life Technologies) kept at -20°C were equilibrated at 4 °C for 15 min and ...
-
bioRxiv - Bioengineering 2020Quote: ... 1.61 nM EGF Recombinant Human Protein (Invitrogen), 0.178 mM Adenine (Sigma) ...
-
bioRxiv - Developmental Biology 2021Quote: ... G-CSF Recombinant Human Protein (Thermo fisher), IP injection ...
-
bioRxiv - Neuroscience 2019Quote: Silencing lentiviral vectors were produced by co-transfecting HEK293T producing cells with lentiviral silencing plasmids GIPZ Human histamine H3 receptor shRNA (Clone V3LHS_638095 or Clone V3LHS_638091, Thermo Scientific) with packing plasmid psPAX2 and envelope coding plasmid pMD2.G (Addgene#12260 and #12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... Transferrin (loading control) was detected with mouse anti-human transferrin receptor antibody (1:500, Cat# 136800, Invitrogen, Waltham, MA). Protein samples (50 µg ...
-
bioRxiv - Neuroscience 2021Quote: ... and anti-transferrin receptor (Invitrogen). For the screening of compounds with the potential to rescue GlyT2 defective phenotypes the following chemicals were used ...
-
bioRxiv - Cell Biology 2023Quote: ... Transferrin receptor (Invitrogen, 13-6890), NHE5 (PA5-37222) ...
-
bioRxiv - Developmental Biology 2019Quote: ... BMP2 recombinant human protein (Thermo Fisher Scientific, #PHC7145) was applied for 1h on cells ...
-
bioRxiv - Neuroscience 2020Quote: ... Recombinant full-length human G2019S-LRRK2 protein (Invitrogen) was used as a protein standard ...
-
bioRxiv - Bioengineering 2022Quote: ... Human BMP-4 Recombinant Protein (Gibco, Catalog # PHC9534). For cell culture of iPSCs on niches ...
-
bioRxiv - Cancer Biology 2022Quote: ... IL-8 Monocyte Recombinant Human Protein (ThermoFisher, PHC0884), and Recombinant Human CXCL1/GROα Protein (R&D Systems ...
-
bioRxiv - Cell Biology 2022Quote: ... Vitronectin (recombinant human protein) was from Fisher Scientific.
-
bioRxiv - Cell Biology 2024Quote: ... 1.61 nM EGF Recombinant Human Protein (Invitrogen, PHG0313), 1.1 μM hydrocortisone (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: Parent CHO-K1 and CHO-K1 cells stably expressing extracellular ACP-tagged human insulin receptors were maintained at 37°C with 5% CO2 in HAM’s F-12 medium (Thermo Fisher) supplemented 10% fetal bovine serum (FBS) ...
-
bioRxiv - Immunology 2021Quote: The COVID-19 receptor-binding domain (RBD) and the N-terminal peptidase domain of human ACE2 were expressed using HEK293F cells (Invitrogen). The COVID-19 RBD (residues Arg319-Phe541 ...
-
bioRxiv - Neuroscience 2023Quote: ... Fetal brains were evaluated by Western blot (corticotropin releasing factor receptor 1 [CRFR1]; glucocorticoid receptor [GR], interleukin [IL]-6 receptor [IL-6R]; IL-17A and β-actin, Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Cell Biology 2021Quote: The expression cassette consisting of a Kozak sequence followed by the coding sequence for human diphtheria toxin receptor (hDTR; UniProt Q53H93) was codon-usage optimized for expression in mice and synthesized (Thermo Fisher Scientific/GeneArt ...
-
bioRxiv - Immunology 2022Quote: The Invitrogen ProtoArray® Human Protein Arrays (ThermoFisher Scientific) are high-density microarrays that contain more than 9,000 unique human proteins individually purified and arrayed onto a nitrocellulose-coated slide ...
-
bioRxiv - Bioengineering 2023Quote: ... and recombinant human interleukin-2 (IL-2) protein (Invitrogen) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... gene expression was analysed using the TaqMan™ Array Human Cardiomyocyte Differentiation by BMP Receptors (Thermo Fisher Scientific, Waltham, MA). Methods are detailed in the online Supplementary material.
-
bioRxiv - Molecular Biology 2020Quote: ... and Transferrin Receptor (1:1,000; Invitrogen). Proteins were detected with HRP-conjugated secondary antibodies (1:10,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti‐transferrin receptor (1:500; Invitrogen), anti‐α‐fodrin (1:5000 ...
-
bioRxiv - Microbiology 2021Quote: ... Vero-hSLAMF1 cells [52] stably express the human measles receptor SLAMF1 and were cultured in Dulbecco modified Eagle medium (DMEM; Thermo Fisher Scientific) containing 5% newborn calf serum (NCS ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.36 pM Recombinant Human Bone Morphogenetic Protein 4 (BMP4, Gibco), and 0.08 pM Activin A (Fisher Scientific) ...
-
bioRxiv - Neuroscience 2020Quote: Glial-Derived Neurotrophic Factor (GDNF) Recombinant Human Protein (ThermoFisher, #PHC7044)
-
bioRxiv - Neuroscience 2020Quote: Brain-Derived Neurotrophic Factor (BDNF) Recombinant Human Protein (ThermoFisher, #PHC7074)
-
bioRxiv - Immunology 2022Quote: ... or IgG1 Fc (human) protein (Thermo Fisher Scientific, Rockford, IL) was added to a final concentration of 10 mg/mL and samples were incubated with gentle mixing for 2 hours at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: ... and pre-coated vitronectin recombinant human protein (ThermoFisher Scientific #A14700) at 0.5 μg/cm2.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Human paraoxonase1 (PON1) recombinant protein was purchased from Thermo Fisher Scientific Inc ...
-
bioRxiv - Systems Biology 2024Quote: ... FGF Basic (aa 10 155) Recombinant Human Protein (Gibco #PHG0021), 1% Penicillin-Streptomycin Solution and 1% L-glutamine ...
-
bioRxiv - Neuroscience 2024Quote: ... or human TGFβ1 recombinant protein (10ng/mL)(ThermoFisher Scientific, PHG9204) for 24 hours followed by addition of lipopolysaccharides (LPS ...
-
bioRxiv - Molecular Biology 2020Quote: ... the receptor Fc-tagged ectodomains present in the conditioned media were captured on protein A-coated 384-plates (Thermo Scientific), and stored at 4 °C until use ...
-
bioRxiv - Immunology 2022Quote: ... and FcR (Fc receptor) true block (Invitrogen) for 12 minutes at 37°C ...