Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for Human C17orf112 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: His-tagged soluble human ACE2 was produced in FreeStyle™ 293-F cells by transfecting soluble human ACE2 (1-741 aa) expression vector plasmid DNA using 293fectin (Thermo Fisher) and purified using HiTrap Chelating column charged with nickel (GE healthcare ...
-
bioRxiv - Neuroscience 2019Quote: ... or three helper plasmids (pCMV-VSV-G, pMDLg/pRRE, pRSV-Rev) in human embryonic kidney 293T (HEK293T) cells using Lipofectamine 2000 (Thermo Fisher Scientific) following the instructions of the manufacturer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and envelope plasmids into human embryonic kidney (HEK 293T) cells using Lipofectamine 3000 according to the manufacturer’s instructions (ThermoFisher Scientific, MA, USA). Cell supernatant containing lentivirus was collected at 24 and 48 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... siRNA-resistant human FOXK1 and FOXK2 cDNAs were synthesized into a pBluescript plasmid (Biobasic®) and subcloned into pENTR (Life technologies®). GST- ...
-
bioRxiv - Immunology 2023Quote: The coding sequence of wild-type human CXCR4 was synthesized by General Biol (Chuzhou, China) and was cloned into the pFastBac transfer plasmid (Invitrogen, Carlsbad, CA). Heat-stabilized BRIL ...
-
bioRxiv - Cancer Biology 2019Quote: ... TCF4 shRNA lentiviral supernatant was generated with ViraPower Lentiviral Packaging Mix (Thermo Fisher Scientific, Waltham, MA, USA) and used to infect LNCaP cells ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse ENKD1 shRNA (nucleotides targeting 403-423 bp, 5′-CGCTCACCCAAGTATGACAAT-3′) were cloned into pLKO.1 (Invitrogen).
-
bioRxiv - Molecular Biology 2022Quote: Lentiviral packaging of shRNA constructs was conducted in 293T/17 cells using Lipofectamine 2000 (Thermo Fisher Scientific). In brief ...
-
bioRxiv - Molecular Biology 2020Quote: Bovine Creb5 shRNAs targeting the Creb5 3’UTR were designed using Block-iT RNAi designer (Thermo Fisher). The most efficient Creb5 shRNA sequence we identified was ...
-
bioRxiv - Cancer Biology 2023Quote: Functional shRNA was cloned into piggybac transposon inducible expression vector PB_tet-on_Apple_shGFP using HindIII and Kpn2L (ThermoFisher)25 ...
-
bioRxiv - Neuroscience 2023Quote: ... Complementary DNA oligomers for the scramble shRNA sequences with ends overlapping with the receiving vector (Thermofisher Scientific) were annealed to generate double stranded oligomers ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA from NT and shRNA transduced EBs was extracted using TRIzol RNA isolation reagents (ThermoFisher Scientific). cDNA was synthesized using iScript cDNA Synthesis Kit from Bio-Rad ...
-
bioRxiv - Molecular Biology 2024Quote: ... Recombinant adenoviruses expressing the GRK2 shRNA were produced using BLOCK-iT™ Adenoviral RNAi Expression System (Invitrogen) according to the manufacturer’s instruction.
-
bioRxiv - Synthetic Biology 2023Quote: ... and 10 μL human IgG (Human IgG Isotype Control, ThermoFisher Scientific #02-7102 ...
-
bioRxiv - Neuroscience 2021Quote: ... Hs05441121_cn (human) (ThermoFisher). This line has been submitted to the European Mouse Mutant Archive (EMMA ...
-
bioRxiv - Neuroscience 2021Quote: ... Hs06560655 (human) (ThermoFisher).
-
bioRxiv - Cell Biology 2024Quote: ... Human fibronectin (Invitrogen) was added to stamps at a concentration of 40 µg/ml for 1 hour ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA from shRNA transduced C2C12 cells was extracted using RNAqueous®-Micro Total RNA Isolation Kit (ThermoFisher). 1 μg total RNA was used to generate one strand cDNA using the qScript™ cDNA Synthesis Kit (Quanta Biosciences) ...
-
bioRxiv - Microbiology 2019Quote: ... HeLa-CD4-shRNA-REAF were selected for resistance to puromycin in media supplemented with 10μg/ml puromycin (Invitrogen).
-
bioRxiv - Cancer Biology 2021Quote: ... MDA-MB-231 F2 cells were then infected with shRNA packaged within lentiviruses in Opti-MEM (Invitrogen 51985034) supplemented with 8µg/mL polybrene (Millipore TR-1003-G) ...
-
Myosin VI regulates ciliogenesis by promoting the turnover of the centrosomal/satellite protein OFD1bioRxiv - Cell Biology 2021Quote: ... pSLIK-NEO myosin VI shRNA was generated with Gateway™ LR Clonase™ II Enzyme mix (ThermoFisher Scientific) by subcloning a nucleotide sequence targeting myosin VI (5’- AGTAATTCAGCACAATATTCCAA - 3’ ...
-
bioRxiv - Microbiology 2022Quote: ... shRNAs targeting BUD23 or overexpressing ORF11-FLAG were seeded in triplicate in 12-well culture plates (Thermo Fisher) at a density of 3 × 105 cells per well and grown for 24 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... the short hairpin RNA (shRNA) for Nrg1 was designed using online BLOCK-iT™ RNAi Designer program (Invitrogen) and the shRNA sequences targeting neuregulin were ...
-
bioRxiv - Neuroscience 2023Quote: ... The ssDNA primers to generate the shRNAs were obtained using the Block-it RNAi web tool (Thermo Scientific) and were as follows ...
-
bioRxiv - Developmental Biology 2020Quote: ... the ells were transfected with human EC-SOD (hEC-SOD) cDNA inserted into a vector plasmid pcDNA3 (5446 nucleotides; Invitrogen Life Technologies, Carlsbad, CA, USA) as previously described,14 using the FuGENE kit (Roche Diagnostics ...
-
bioRxiv - Biophysics 2020Quote: The plasmid pT7-7 containing human aSyn cDNA was transformed into Escherichia coli One Shot® BL21 (DE3) Star™ (Thermo Fisher Scientific, USA). 0.5 L cultures of E ...
-
bioRxiv - Neuroscience 2021Quote: ... Plasmids were purified with HiPure Plasmid Maxiprep kits (Invitrogen).
-
bioRxiv - Cell Biology 2022Quote: Purified plasmids (GeneJET Plasmid Miniprep Kit, Thermo Scientific K0503) were microinjected into embryos of nos/attP40 flies for mVenus fusion gene construct injection and nos-Cas9 flies for CRISPR mutagenesis ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were isolated using GeneJet Plasmid Miniprep Kit (ThermoFisher).
-
bioRxiv - Cell Biology 2020Quote: ... and VIC labelled human β actin endogenous control probe (Human - 4326315E) or RNA28S5 (Human - Hs03654441_s1) (Thermo Fisher Scientific) so that amplified mRNA can be normalised to β actin or RNA28S5 ...
-
bioRxiv - Neuroscience 2021Quote: ... Human recombinant fibroblast growth factor (human FGF2) (10 ng/ml, Invitrogen) was added to Dulbecco’s Modified Eagle’s Medium (DMEM)/F-12 (Gibco) ...
-
bioRxiv - Immunology 2022Quote: ... Human T cells were activated with human CD3/CD28 Dynabeads (Invitrogen), at a bead:cell ratio of 2:1 and transduced using supernatant collected from Phoenix-AMPHO cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antibodies used for human samples were anti-human CD31 (#17031942, Invitrogen), anti-human CD45 (#17945942 ...
-
bioRxiv - Plant Biology 2019Quote: ... in frame with a downstream GFP reporter gene in the pB7FWG,0 plasmid, or in the pB7WG plasmid respectively (Ghent plasmids collection, http://bccm.belspo.be/index.php) via Gateway technology (Invitrogen). As the S2Lb fragment was cloned without STOP codon ...
-
bioRxiv - Developmental Biology 2020Quote: ... the ells were transfected with human EC-SOD (hEC-SOD) cDNA inserted into a vector plasmid pcDNA3 (5446 nucleotides; Invitrogen Life Technologies, Carlsbad, CA, USA) as previously described,14 using the FuGENE kit (Roche Diagnostics ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were extracted using GeneJET plasmid miniprep kit (Thermo Fisher) per manufacturer protocols ...
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmids were isolated using PureLink Quick Plasmid Miniprep Kit (Invitrogen) and Sanger sequenced with the universal primers M13Forward and M13Reverse.
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmids were isolated using PureLink Quick Plasmid Miniprep Kit (Invitrogen) and quantified by spectrophotometric analysis (Biophotometer ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid was purified using Purelink-Midi plasmid purification kit (Invitrogen). Plasmid transfection was done using Fugene HD (Promega) ...
-
bioRxiv - Microbiology 2022Quote: ... plasmids extracted using a GeneJet Plasmid Purification Kit (Thermo Scientific), and constructs sequence-verified using Sanger sequencing (Genewiz).
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmids were isolated (GeneJET Plasmid Miniprep kit, Thermo Fisher Scientific) and confirmed by restriction enzyme digestion and/or Sanger sequencing (Eurofins ...
-
bioRxiv - Plant Biology 2023Quote: ... The plasmids were extracted using Plasmid DNA Miniprep Kit (ThermoFisher), and the sequences were confirmed by sequencing of the ligation sites (Macrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... followed by plasmid isolation (GeneJET Plasmid Miniprep System; Thermo Fisher). Isolated plasmids were test digested and sequenced.
-
bioRxiv - Molecular Biology 2021Quote: ... Cells with stable integration of the shRNA construct were determined by a selection of puromycin-resistant colonies (0.5 μg/ml puromycin; Invitrogen). The efficacy of TRMT2A silencing effect was determined by qPCR and Western blot ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 µg PAX2 and 4 µg shRNA in pLKO.1 backbone using Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer’s instructions ...
-
The pan-cancer lncRNA PLANE regulates an alternative splicing program to promote cancer pathogenesisbioRxiv - Cancer Biology 2020Quote: ... and the annealed shRNA oligos were inserted into the digested vector using the T4 DNA ligase (ThermoFisher Scientific, #EL0014). The lentiviral particles were packaged via co-transfection of FH1-tUTG vector inserted with shRNA oligos (44 μg) ...
-
bioRxiv - Cell Biology 2022Quote: ... The shRNA target sequence was designed for protein knockdown using the BLOCK-iT RNAi Designer tool (Thermo Fisher Scientific). A cassette containing the pre-shRNA sequence was inserted into pBAsi-mU6 (Takara Bio) ...
-
bioRxiv - Molecular Biology 2022Quote: ... shRNA sequences targeting the murine Uhmk1 gene were designed using the BLOCK-IT™ RNAi Designer tool (Invitrogen™), cloned into the MSCV-U3-H1-Stuffer entry vector digested with BglII and HindIII and subcloned into the retroviral vector pMSCV-puromycin-IRES-EGFP siRNA digested with the NotI and ScaI [55] ...
-
bioRxiv - Cell Biology 2023Quote: Two sets of USP3 shRNAs were designed against its target sequence and cloned independently into pSilencer2.1-U6 hygro vector (Ambion). Scrambled shRNA with limited homology to any known sequences was cloned into the same vector and could serve as the negative control ...
-
bioRxiv - Genetics 2023Quote: ... RKO and HT-1080 shRNA+ cells from the competition proliferative assay experiment were selected with Geneticin/G418 Sulfate (Gibco) for 7 days and checked for GFP expression ...