Labshake search
Citations for Thermo Fisher :
151 - 200 of 6145 citations for GDF 11 BMP 11 Human HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... 1X MEM Non-essential amino acids (Thermo Fisher #11-140-050) containing 25% Bovine Albumin Fraction V (Thermo Fisher #15260037) ...
-
bioRxiv - Biophysics 2021Quote: ... and biotin-11-dUTP (Invitrogen, Life Technologies, Grand Island, NY, USA) in a molar ratio of 1:1:1:0.7:0.3 ...
-
bioRxiv - Plant Biology 2021Quote: The pENTR™ 11 Dual Selection Vector (Thermo Fisher Scientific, USA) was digested by KpnI and XhoI ...
-
bioRxiv - Cell Biology 2020Quote: ... Anti IL-1 alpha (Thermo Fisher Scientific; Cat.# 11-7118-81).
-
bioRxiv - Cancer Biology 2021Quote: ... 11 Cells were cultured in either αMEM (12,000,063, Thermo-Fisher Scientific) supplemented with 5% v/v foetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.1 mM non-essential amino acids (Fisher Scientific, 11-140-050), 1 mM sodium pyruvate (Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... WTC-11 fibroblasts were routinely passaged using TrypLE Select (ThermoFisher #12563011), and BJ fibroblasts ...
-
bioRxiv - Cancer Biology 2022Quote: Kuramochi cells (BRCA2-mutant (11)) were cultured in RPMI-1640 (ThermoFisher) with 10% Fetal Bovine Serum (FBS) ...
-
bioRxiv - Genetics 2022Quote: ... MEM non-essential amino acids (Fisher Scientific, Cat #: 11-140-050), and 2 μg/mL heparin (Sigma Aldrich ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary antibodies used were rat CD68 (FA-11, 1:100; ThermoFisher), rabbit cardiac troponin I (1:50 ...
-
bioRxiv - Genomics 2022Quote: ... 40 μl of anti-rabbit Dynabeads (Thermofisher, cat # 11-204-D) were washed twice with PBS/BSA and incubated with either 0.5 μl of anti-TBP antibody (gift from Dr ...
-
Pathogenic variants of sphingomyelin synthase SMS2 disrupt lipid landscapes in the secretory pathwaybioRxiv - Cell Biology 2022Quote: ... The amplified DNA was inserted into pENTR™11 (Invitrogen, A10467) using the BamHI and NotI restriction sites ...
-
bioRxiv - Immunology 2020Quote: ... 11-plex TH1/TH2 mouse ProcartaPlex multiplex immunoassay (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Peptide extracts were labelled with TMT-11 reagents (Thermo Fisher Scientific) as described below.
-
bioRxiv - Biophysics 2021Quote: ... or biotin-11-dUTP (Invitrogen, Life Technologies, Grand Island, NY, USA) in a molar ratio of 1:1:1:0.7:0.3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... day 11 magnetoids were imaged using an inverted microscope (EVOS, Invitrogen). Using ImageJ ...
-
bioRxiv - Developmental Biology 2022Quote: ... Day 11 hNTmOs were observed using an inverted microscope (EVOS, Invitrogen). A magnet (Supermagnete ...
-
bioRxiv - Genomics 2019Quote: ... anti-CD3 FITC (clone OKT3, cat. no. 11-0037-41, Invitrogen), anti-CD8 Pacific Blue (clone 3B5 ...
-
bioRxiv - Neuroscience 2021Quote: ... each separated by a layer glass wool (#11-388, Fisher Scientific). To re-humidify ...
-
bioRxiv - Microbiology 2020Quote: ... anti-CD44 (No. 11-0441; eBioscience/Affymetrix, Santa Clara, CA, USA), anti-CD62L (No ...
-
bioRxiv - Microbiology 2020Quote: ... anti-CD4 (No. 11-0042; eBioscience/Affymetrix, Santa Clara, CA, USA), anti-CD3 (No ...
-
bioRxiv - Immunology 2020Quote: ... 11-plex TH1/TH2 mouse ProcartaPlex multiplex immunoassay (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... The IVM medium consists of M199 medium (GIBCO, 11-150-059) with 20% Systemic Serum Substitute (Irvine Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... 11 μm thick sections were mounted onto Superfrost Plus (Fisher Scientific) slides ...
-
bioRxiv - Bioengineering 2022Quote: ... 1% non-essential amino acids (NEAA; Fisher Scientific, 11-140-050), and 1% penicillin-streptomycin (P/S ...
-
bioRxiv - Microbiology 2022Quote: ... using TMT 11-plex isobaric mass tagging reagents (Thermo Fisher Scientific), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cultures were maintained in RPMI1640 media (Thermo Fisher, 11-875-093) supplemented with 10% FBS (Corning ...
-
bioRxiv - Cell Biology 2023Quote: ... Digested peptides were labeled with TMT 11-plex reagents (Thermo Fisher). TMT-labeled samples were pooled and acidified with MS-grade formic acid (Sigma ...
-
bioRxiv - Systems Biology 2023Quote: ... K562 cells were cultured in RPMI 1640 (Gibco, 11-875-119) media supplemented with penicillin (10,000 I.U./mL) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1.3% MEM Nonessential Amino Acids 100x (Fisher Scientific, 11-140-050), 0.1% B-ME 55mM (2-Mercaptoethanol ...
-
bioRxiv - Cell Biology 2023Quote: ... and cells maintained in RPMI-1640 medium (Gibco, 11-875-119) supplemented with 10% fetal bovine serum (Corning ...
-
bioRxiv - Developmental Biology 2023Quote: ... FITC-conjugated mouse anti-CD34 (1:200, 11-0341-82, Invitrogen), mouse anti-LEF1 (1:100 ...
-
bioRxiv - Cell Biology 2021Quote: ... human female adenocarcinoma of the mammary gland) were maintained in Dulbecco’s Modified Eagle Medium High Glucose (ThermoFisher Scientific, #11-965-118), 10% foetal bovine serum (Bovogen ...
-
bioRxiv - Molecular Biology 2023Quote: The surface of all cultureware used for the maintenance and propagation of human pluripotent stem cells (WTC-11 line) was coated with Corning Matrigel (Fisher Scientific) prior to cell seeding ...
-
bioRxiv - Microbiology 2020Quote: ... and the Human embryonic kidney (HEK293) cells (Gibco) in Freestyle F17 expression medium (Gibco) ...
-
bioRxiv - Neuroscience 2022Quote: Human derived HEK293 cells (Invitrogen, Inchinnan, UK, R75007) stably transfected with cAMP GloSensor™ (pGloSensor-22F ...
-
bioRxiv - Neuroscience 2023Quote: Grip TiteTM Human Embryonic Kidney (GT HEK293) (Invitrogen) cells were grown as previously described (Chałupnik et al ...
-
bioRxiv - Developmental Biology 2021Quote: ... and CD36 (1:100; FITC, conjugated; Thermo Fisher Scientific, 11-0369-42), with a viability dye ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Centromeric repeat probes were amplified by PCR using Biotin-11-dUTP (Thermofisher) with primer TCTAGCACTTGTAATCAATCAAATTC and AGAAGTGAGAAGAAAGACTTG ...
-
bioRxiv - Immunology 2021Quote: ... RNA yield was quantified using a DeNovix DS-11 Spectrophotometer (ThermoFisher Scientific). Total RNA (0.5 μg ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 g anti-μ cadherin-11 (Thermo Fisher Scientific Cat#32-1700) or 4 μg anti-HA antibodies (Millipore Sigma Cat#H6908) ...
-
bioRxiv - Neuroscience 2020Quote: ... nonessential amino acids solution (100 μM, Life technologies, Catalog #11-140-050), β-mercaptoethanol (100 µM ...
-
bioRxiv - Biochemistry 2021Quote: ... 11 μg pSPAX2 and 6.4 μg pVSVG using Lipofectamine 2000 (Thermo Fisher). The transfection media was replaced by plating media supplemented with 13 mg/mL bovine serum albumin (BSA ...
-
bioRxiv - Biochemistry 2020Quote: Gateway LR Clonase II Enzyme Mix (Fisher Scientific, Cat. # 11-791-020)
-
bioRxiv - Cell Biology 2021Quote: ... Peptide samples were then reacted with TMT 11-plex reagents (Thermo Fisher) in 40% v/v acetonitrile and incubated for one hour at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... -sodium pyruvate media (Cat no. 11-965-092; Gibco by Life Technologies) supplemented with 10% heat-inactive FBS (Cat no.A3840001 ...
-
bioRxiv - Cell Biology 2020Quote: ... collected by centrifugation and resuspended in DMEM/F12 (Gibco, 11-330-057) supplemented with 10% FBS (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... CD45- were incubated with CD31-FITC (1:1000, Invitrogen 11-0311-82), CD45-FITC (1:1000 ...
-
bioRxiv - Biochemistry 2022Quote: ... and labeled with 11-plex Tandem Mass Tag (TMT) reagents (Thermo Scientific) according to manufacturer’s recommendations.
-
bioRxiv - Cell Biology 2022Quote: ... complete M199 medium consisted of M199 medium (11-150-059, Fisher Scientific), 10% fetal bovine serum ...