Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for GAPDH Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... MAb dilutions were prepared in 1× minimal essential medium (MEM; Gibco) supplemented with 2% FBS ...
-
bioRxiv - Neuroscience 2021Quote: ... and TaqMan probes (GAPDH Mm99999915_g1, SorCS2 Mm00473050_m1; Thermo Fisher Scientific) were used according to manufactureŕs instructions ...
-
bioRxiv - Pathology 2019Quote: ... (Ambion 4390843)] and a select GAPDH positive control silencer [(C+) (Ambion 4390849) were employed as control reactions.
-
bioRxiv - Biochemistry 2019Quote: ... GAPDH antibody (1:2000, Invitrogen # MA5-15738-HRP, RRID: AB_2537659) was used as a loading control ...
-
bioRxiv - Physiology 2019Quote: ... and with Glyceraldehyde-3-phosphate dehydrogenase (GAPDH, 4352934E, Applied Biosystems) as an endogenous control gene ...
-
bioRxiv - Microbiology 2019Quote: ... or anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:5,000; Ambion), or anti-p24 (1:1,000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Blots were probed with the following primary antibodies: GAPDH (ThermoFisher), SQSTM1 and LC3 (Cell Signaling).
-
bioRxiv - Bioengineering 2021Quote: ... with mouse Gapdh endogenous control mix (4352339E, Thermo Fisher Scientific). Statistical analysis was performed by two-way ANOVA.
-
bioRxiv - Cell Biology 2021Quote: ... Id4 and GAPDH was performed with SYBR green (Applied Biosystems) using the primers listed in Supplementary Table 1.
-
bioRxiv - Neuroscience 2022Quote: ... Hs01372957_m1 (UBE3A-ATS) and Hs 4325792 (GAPDH) all from ThermoFisher. For quantification of UBE3A mRNA ...
-
bioRxiv - Neuroscience 2021Quote: ... Custom primers for the GAPDH gene (PN4331182; Thermo Fisher Scientific), NKX2.2 gene (PN4331182 ...
-
bioRxiv - Developmental Biology 2019Quote: ... HES5 and GAPDH was performed with Taqman (ThermoFisher, Scientific, UK) gene expression assays.
-
bioRxiv - Cancer Biology 2020Quote: ... and GAPDH (Hs02758991_g1) were purchased from Applied Biosystems (Carlsbad, CA). Assays were performed in triplicate according to manufacturer recommendations ...
-
bioRxiv - Bioengineering 2021Quote: ... TXNL1 and ZNRF4 against reference genes 18S and GAPDH (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... and GAPDH (GA1R, Invitrogen, Cat. #MA5-15738, 20 ng/ml), as well as rabbit polyclonal antibodies against Phospho-Histone H3 (Ser10 ...
-
bioRxiv - Neuroscience 2022Quote: ... or mouse anti-GAPDH (1:25.000, polyclonal, Ambion, Cat # AM4300) antibodies (Abs) ...
-
bioRxiv - Genetics 2023Quote: ... Relative expression was normalized to GAPDH (Thermo Fisher Sci., #4310884E) levels.
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies were used: anti-GAPDH (Thermofisher GA1R), anti-GFP (Abcam 6673) ...
-
bioRxiv - Bioengineering 2023Quote: ... and Taqman probes for GAPDH control (Thermo Fisher, Cat # 4326317E) and target genes (IDT ...
-
bioRxiv - Cell Biology 2023Quote: ... for GAPDH and the SuperSignal Pico PLUS kit (Thermo Fisher) for Lamin A/C ...
-
bioRxiv - Genomics 2023Quote: ... human GAPDH (Assay ID Hs02786624_g1; Thermo Fisher Scientific, Waltham, MA), for each individual gene expression assay ...
-
bioRxiv - Cancer Biology 2023Quote: ... GAPDH (MA5-15738) was purchased from Invitrogen (Waltham, MA, USA).
-
bioRxiv - Genetics 2023Quote: ... or anti-GAPDH antibody diluted at 1:10000 (Invitrogen, MA515738), and revealed with an HRP-conjugated anti-mouse IgG antibody diluted at 1:10000 (Abcam ...
-
bioRxiv - Immunology 2023Quote: ... C5 (Hs01004342_m1) and GAPDH (Hs99999905_m1) all purchased from Applied Biosystems. RT-qPCR reactions were performed according to the manufacturers instructions using a QuantStudio-5 Real-Time PCR machine (Applied Biosystems ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and Gapdh was conducted using prevalidated Taqman primers (Life Technologies catalog #s ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-GAPDH (1:2000, Invitrogen, Cat.39-8600, RRID:AB_2533438), rabbit anti-DUSP6 (1:1000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The primers purchased from TaqMan were: GAPDH (Thermo Fisher, #4310884E), AR-FL (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... Then recombinant dsDNA fragment (add to > 400 ng/μl final concentration) or recombinant single-strand DNA (ordered from Invitrogen or IDT ...
-
bioRxiv - Microbiology 2020Quote: ... followed by incubation with rabbit antibodies against SFTSV-N as primary antibodies and HRP-conjugated recombinant protein A/G (Cat. No. 32490, Thermo Scientific, Rockford, IL, USA) as secondary antibodies ...
-
bioRxiv - Biochemistry 2022Quote: ... recombinant human RPA or RPA-variants (2 μM) were incubated with 250 nM of recombinant Aurora B kinase (Invitrogen Inc.) in kinase reaction buffer (50 mM Tris-HCl ...
-
bioRxiv - Microbiology 2022Quote: ... we used the following antibodies: α-complement C3 (primary: mAb 11H9, ThermoFisher catalog no ...
-
bioRxiv - Biochemistry 2020Quote: ... mAb was eluted using IgG Elution Buffer (pH 2.8; Thermo Fisher Scientific). Protein fractions (1 mL/fraction ...
-
bioRxiv - Microbiology 2021Quote: ... Streptavidin Molecular Probe Alexa-Fluor-633 conjugated secondary mAb (1µg/ml) (Invitrogen) was used to detect biotinylated antibodies 7E9 (BioLegend ...
-
bioRxiv - Cancer Biology 2021Quote: ... Membranes were blotted with the following antibodies: Actin (Invitrogen, MA1744, Mouse mAb) at 1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... 30 µL serially diluted mAb labeled with Alexa Fluor 647 dye (ThermoFisher) was added to wells and incubated for 30 minutes at 4 °C ...
-
bioRxiv - Immunology 2020Quote: ... mAbs were concentrated using Pierce™ 3K Protein Concentrator PES (Thermo Scientific).
-
bioRxiv - Immunology 2021Quote: ... Panels used the following mAb: EF450-conjugated antibody against CD25(ThermoFisher Scientific), PE-conjugated antibody against CD127 (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Anti-Ty mAb BB2 beads bound to Protein G Dynabeads (Life Technologies) were precleared and incubated with cell lysates ...
-
bioRxiv - Immunology 2022Quote: ... Competitor mAbs were biotinylated using EZ-Link sulfo-NHS-biotin (Thermo Scientific) for 2h at room temperature (RT) ...
-
bioRxiv - Microbiology 2022Quote: ... The following antibiotics were supplemented when appropriate for Mabs: hygromycin B (Invitrogen)(125 μg/ml for liquid media ...
-
bioRxiv - Microbiology 2023Quote: ... The V5 epitope was detected with mouse mAb anti-V5 (Invitrogen; R96025). Toxoplasma-specific antibodies include mAb mouse anti-IMC1 [53] ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-ErbB3 mouse mAb (IF: 1:100, WB: 1:1000; RTJ2, Invitrogen); anti-E-cadherin mouse mAb (1:1000 ...
-
bioRxiv - Microbiology 2023Quote: ... cells were incubated in □-V5 mouse monoclonal antibodies (mAb) (Thermo Life Technologies) diluted 1:500 in 1% milk in PBS for 2 h at RT ...
-
bioRxiv - Immunology 2023Quote: ... Panels used the following mAb: EF450-conjugated antibody against CD25(ThermoFisher Scientific), PE-conjugated antibody against CD127 (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... The following monoclonal antibodies (mAbs) were used: CD45 APC (30-F11, Invitrogen); CD11b FITC (M1/70 ...
-
bioRxiv - Microbiology 2023Quote: ... Anti-TY mAb BB2 beads bound to Protein G Dynabeads (Life Technologies) were precleared and incubated with the nuclear fractions overnight ...
-
bioRxiv - Microbiology 2023Quote: ... Anti-TY mAb BB2 beads bound to Protein G Dynabeads (Life Technologies) were precleared and incubated with the nuclear fractions overnight ...
-
bioRxiv - Microbiology 2024Quote: ... The V5 epitope was detected with mouse mAb anti-V5 (Invitrogen; R96025). Toxoplasma-specific antibodies include rabbit pAb anti-IMC6 (80) ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative RT-PCR reaction was performed with primers (Nmnat1-forward: AGAACTCACACTGGGTGGAAG, Nmnat1-reverse: CAGGCTTTTCCAGTGCAGGTG, Gapdh-forward: TGCCCCCATGTTTGTGATG, Gapdh-reverse: TGTGGTCATGAGCCCTTCC with reaction mixture (ThermoFisher, SYBR® Green PCR Master Mix) and monitored with Prism 7900HT (ABI ...
-
bioRxiv - Cell Biology 2020Quote: ... 10 ng/ml recombinant human GDNF (Invitrogen, USA) and 1% fetal bovine serum (FBS ...