Labshake search
Citations for Thermo Fisher :
401 - 450 of 5395 citations for Ferritin heavy chain FTH1 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... Quantitative-real-time polymerase chain reaction (qRT-PCR) was performed using TaqMan Fast Advanced MasterMix (Applied Biosystems MA, USA) and Taqman gene expression assays for OVCH1-AS1 (Hs04333030_m1 ...
-
bioRxiv - Systems Biology 2023Quote: ... We quantified cDNA abundance using quantitative-polymerase chain reaction (qPCR) using the QuantStudio 5 Real-Time PCR system (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... IL-10: Rn00563409_m1) for real time reverse transcriptase polymerase chain reaction were from Applied Biosystems (Foster City, CA, USA).
-
bioRxiv - Microbiology 2024Quote: ... Real-time Polymerase Chain Reaction (qPCR) was conducted in a StepOnePlus™ Real-time PCR system (Applied Biosystems®) to analyze the relative expression of the genes of inducible nitric oxide synthase (iNOS ...
-
bioRxiv - Biophysics 2021Quote: ... S309 and CR3022 antibodies heavy and light variable region sequences(33, 34, 58) were synthesized and cloned into pcDNA3.1 vector (Invitrogen™, Thermo Fisher Scientific, Waltham, MA, USA) in-frame with human IgG heavy or light chain Fc fragment ...
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and recombinant human FGF2 (Invitrogen) at 20 ng/ml ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...
-
bioRxiv - Microbiology 2023Quote: ... human Gas6 (Invitrogen, cat# BMS2291), mouse Axl (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... Human primary astrocytes (ThermoFisher #N7805200) were maintained as described in user manual ...
-
bioRxiv - Systems Biology 2023Quote: ... and human IgE-PE (ThermoFisher). Antibody details are shown in Table S4 ...
-
bioRxiv - Genomics 2023Quote: ... human p53 (Invitrogen, PA5-27822), MDM2 (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... human IFN-gamma ELISA (Invitrogen) and granzyme B ELISA (R&D Systems ...
-
bioRxiv - Physiology 2023Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knockdown GR ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD235a (#17998742, Invitrogen), anti-human CD326 (EpCAM ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD45 (#17945942, Invitrogen), anti-human CD235a (#17998742 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Cot-1 DNA (Invitrogen), 3M NaAc and 100% cold EtOH ...
-
bioRxiv - Immunology 2024Quote: ... or anti-human (Invitrogen #A11013) secondary antibodies at 20 μg/mL in PBS/2% BSA for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... human COT1 DNA (#15279011, Invitrogen) and 3 volumes of ethanol (#10000652 ...
-
bioRxiv - Neuroscience 2021Quote: Primary neurons expressing lentivirally delivered clathrin heavy chain (CHC)-targeting shRNA or a scramble version (DIV14) were starved for 1 hour in osmolarity-adjusted NBA medium (Gibco) at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Quantitative real-time polymerase chain reaction (qPCR) was performed on a QuantStudio 12K Flex system (Applied Biosystems; Foster City, CA) using rat-specific Taqman gene primers (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... quantitative real time polymerase chain reaction (qPCR) was performed using PowerUp SYBR Green Master Mix kit according to the manufacturer’s protocol (Applied Biosystems) and LightCycler 480 II machine (Roche Applied Science) ...
-
bioRxiv - Immunology 2021Quote: Multiplex quantitative polymerase chain reaction (qPCR) was carried out using a QuantStudio 6 Flex Real-Time PCR System (ThermoFisher Scientific) as described previously [23] ...
-
bioRxiv - Zoology 2019Quote: Gene expression levels were analysed with quantitative polymerase chain reaction (qPCR) using a StepOnePlus Real-Time PCR System (Applied Biosystems) as described previously [25] ...
-
bioRxiv - Systems Biology 2020Quote: Pooled single cell samples were prepared for multiplex real-time quantitative polymerase chain reaction (RT-qPCR) with the Biomark HD system using VILO III (ThermoFisher) reverse transcription of RNA into cDNA followed by 22 cycles of pre-amplification (Taqman pre-amp master mix ...
-
bioRxiv - Neuroscience 2020Quote: ... The prepared RNA was assayed for MALAT1 and cyclophilin A levels using primer/TaqMan probe sets with an EXPRESS One-Step SuperScript quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) kit (Invitrogen). qRT-PCR plates were run on StepOnePlus Real-Time PCR machines (Applied Biosystems ...
-
bioRxiv - Neuroscience 2020Quote: ... Pooled single cell samples were prepared for multiplex real-time quantitative polymerase chain reaction (RT-qPCR) with the Biomark HD system using VILO III (ThermoFisher) reverse transcription of RNA into cDNA followed by 22 cycles of pre-amplification (Taqman Pre-amp Master Mix ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids containing the Fab heavy chains and light chains were chemically co-transfected into an afucosylated ExpiCHO cell line using the ExpiFectamine CHO Transfection Kit (Gibco). After 9 days of transient expression ...