Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for Ephrin type A receptor 8 EphA8 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... IL-8 Monocyte Recombinant Human Protein (ThermoFisher, PHC0884), and Recombinant Human CXCL1/GROα Protein (R&D Systems ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... while IL-8 production was evaluated using human IL-8 ELISA kit (Thermo Scientific), with assay range of 2-250 pg/mL.
-
bioRxiv - Neuroscience 2021Quote: ... HEK293S GnTI- cells were grown at 37°C with 8% carbon dioxide in Freestyle 293 medium (Gibco) supplemented with 2% (v/v ...
-
bioRxiv - Cell Biology 2022Quote: Human HEK293 cells were cultured at 37 °C and 5% CO2 in DMEM (ThermoFisher Scientific), supplemented with 10% fetal bovine serum (ThermoFisher Scientific) ...
-
bioRxiv - Biochemistry 2019Quote: Human embryonic kidney 293 (HEK293) cells were grown in high glucose DMEM (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (Sigma ...
-
bioRxiv - Developmental Biology 2023Quote: ... The vectors were then transfected into human embryonic kidney cells (HEK293) with Fectin-system (Invitrogen). Protein from culture supernatant was isolated as previously described [46 ...
-
bioRxiv - Molecular Biology 2023Quote: Human embryonic kidney fibroblasts (HEK293, RRID:CVCL_0045) were grown in Dulbecco’s Modified Eagle Medium (DMEM, ThermoFisher) supplemented with 10% fetal calf serum (FBS ...
-
bioRxiv - Cell Biology 2023Quote: Wild-type human HCAR2 was cloned into pFastBac vector (Gibco) with N-terminal hemagglutinin (HA ...
-
bioRxiv - Microbiology 2020Quote: ... All human MARCH cDNAs were cloned into pCDNA3.1/myc-His A (Invitrogen) and were then subcloned into pBJ5 ...
-
bioRxiv - Microbiology 2023Quote: ... human MARCH4 and mouse MARCH2 (mMARCH2) into pcDNA3.1/myc-His A (Invitrogen) and pBJ5 vector have been previously described (10) ...
-
bioRxiv - Genomics 2024Quote: Human iPSCs were cultured in Essential 8 Medium (Gibco/Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... HEK293 cells were transfected with either NSUN6 wild-type and the miCLIP-mutant construct using Lipofectamine 2000 (Life Technologies) and harvested 24 hours later.
-
bioRxiv - Cell Biology 2023Quote: ... wild type HEK293 or HEK293A (for figure 1A) cells were transfected with the indicated plasmids with Lipofectamine2000 Reagent (Invitrogen) as per manufacturer protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 T-Rex (referred to as HEK293, cat.no. R71007, Invitrogen) and NIH3T3 cells were grown in DMEM Glutamax® (Thermo Fisher Scientific ...
-
Modified N-linked glycosylation status predicts trafficking defective human Piezo1 channel mutationsbioRxiv - Biophysics 2020Quote: ... HEK293S GnT1-/- or HEK293 cells (ThermoFisher Scientific, Cat. No. R78007) using Lipofectamine 3000 transfection reagent (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Mouse SGK1.1 (wild type and constitutively active mutant S515D) cloned into pcDNA3.1/V5-His-TOPO (Invitrogen) were kind gifts from Dr ...
-
bioRxiv - Neuroscience 2021Quote: HEK293 cells (Invitrogen) were grown in DMEM (1g/L glucose ...
-
bioRxiv - Synthetic Biology 2022Quote: HEK293 cells (ThermoFisher; further authenticated by assessing cell morphology and growth rate ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Human V1A Receptor-CHO cell line (CHO -V1a) was cultured in Ham’s F12 (Life Technologies) supplemented with 10% fetal bovine serum (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cells were stained with human FITC conjugated transferrin receptor (CD71; ThermoFisher: 11-0719-42) and human FITC conjugated glycophorin A (CD235a ...
-
bioRxiv - Biochemistry 2020Quote: Human embryonic kidney cells 293 (HEK293) cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: HMC3 human microglia or HEK293 cells were transfected with Lipofectamine 3000 with Plus reagent (Invitrogen L3000001) per manufacturer instructions with 0.8 μL of Lipofectamine 3000 ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmids were transfected into HEK293 human embryonic kidney cells using Lipofectamine2000 (Invitrogen, Carlsbad, CA, USA). The recombinant proteins were purified with anti-FLAG agarose affinity gel (A2220 ...
-
bioRxiv - Biochemistry 2021Quote: Human HEK293S GnTI- cells were cultured as suspension at 37°C in FreeStyle293 expression medium (Invitrogen) supplemented with 2% (vol/vol ...
-
bioRxiv - Neuroscience 2022Quote: Human embryonic kidney 293 cells (HEK293, ECACC) were cultured in Dulbecco’s Modified Eagle’s Medium (Thermo Fisher) with 10% fetal bovine serum (Hyclone) ...
-
bioRxiv - Cell Biology 2022Quote: Human embryonic kidney (HEK293) cells from ATCC were cultured in Dulbecco’s Modified Eagle’s medium (DMEM, Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Neuroscience 2023Quote: Human embryonic kidney cells (HEK293) were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Gibco #12430-054) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2023Quote: Human embryonic kidney (HEK293, HEK293A) cell lines were grown in Dulbeco’s Modified Eagle medium (DMEM, Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Microbiology 2021Quote: ... or a type IV DQTM collagen conjugate from human placenta (Invitrogen). Reactions were prepared in technical triplicate or quadruplicate by mixing 20 µL of substrate at 0.25 mg/mL with 80 µL of reaction buffer and 100 µL of bacterial suspension ...
-
bioRxiv - Molecular Biology 2020Quote: ... The wild-type complemented HEK293 RAD51 S14A mutant was generated by co-transfecting pcDNA5/FRT encoding wild-type RAD51 and pcDNA-DEST26 (Invitrogen), followed by single cell sorting (FACS ...
-
bioRxiv - Microbiology 2022Quote: ... the IFN-β–Luc was co-transfected with pRL-TK in wild type and 4EHP-KO HEK293 cells using Lipofectamine 2000 according to the manufacturer′s protocol (Invitrogen). 24 h after transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... fusion protein was transfected in human embryonic kidney (HEK293) cells in a 6-well format with or without full-length wild-type BACE1 using Lipofectamine 2000 (Invitrogen). After 6-8h transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... fusion protein was transfected in human embryonic kidney (HEK293) cells in a 6-well format with or without full-length wild-type BACE1 using Lipofectamine 2000 (Invitrogen) as described previously (31) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human IL-6 and IL-8 ELISAs were from Thermofisher Scientific ...
-
bioRxiv - Immunology 2020Quote: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA from HEK293 cells and human brain prefrontal cortex were isolated with the TRIzol reagent (Ambion) according to the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2020Quote: Human Embryonic Kidney 293 cells (HEK293, ATCC CRL-1573) were grown under standard conditions in DMEM (Gibco) supplemented with 10% FBS (BioConcept) ...
-
bioRxiv - Neuroscience 2023Quote: The human embryonic kidney cells (HEK293 and HEK293T) were maintained in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) supplemented with 15% Fetal Bovine Serum (FBS ...
-
bioRxiv - Microbiology 2021Quote: ... an 8×His-tag and a Twin-Strep-tag were produced in ExpiCHO-S cells (ThermoFisher) as described previously [10].
-
bioRxiv - Genetics 2023Quote: ... androgen receptor (Invitrogen), PTK2 (Invitrogen) ...
-
bioRxiv - Biochemistry 2022Quote: HEK293 and commercially available Flp-In T-REx HEK293 cells (Invitrogen; R78007) were cultured in DMEM (GIBCO ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 cells (ThermoFisher Scientific) were cultured in DMEM/F-12 ...
-
bioRxiv - Bioengineering 2022Quote: ... FreeStyle HEK293 cells (ThermoFisher) were used for recombinant S protein production ...
-
bioRxiv - Molecular Biology 2019Quote: ... HEK293 FT cells (ThermoFisher) were co-transfected with plasmids pCMV-dR8.2 dvpr (gag-pol ...
-
bioRxiv - Synthetic Biology 2019Quote: HEK293 cells (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: HEK293 cells (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293-FT (Invitrogen # R70007) cells were grown in Dulbecco’s Modified Eagle Medium (ThermoFisher #11965118 ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 (Thermo Fisher Scientific) were cultured in DMEM (Dulbecco’s Modified Eagle Medium ...
-
bioRxiv - Genomics 2020Quote: ... human Malat1 (positive control, Type 1 Probe, VA1-11317, Thermo Fisher Scientific), and bacterial DapB (negative control ...
-
bioRxiv - Biophysics 2022Quote: ... CaVβ3-stable and HEK293S GnTI-cells were grown in suspension at 37°C supplied with 8% CO2 in FreeStyle 293 Expression Medium (Gibco) supplemented with 2% fetal bovine serum (FBS ...