Labshake search
Citations for Thermo Fisher :
501 - 550 of 1551 citations for Echovirus Antigen Recombinant since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 10 ng/ml human recombinant epidermal growth factor (Fisher Scientific PHG0311), 5 mM glucose (Fisher Scientific A2494001) ...
-
bioRxiv - Immunology 2023Quote: ... TotAZsk6 embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting TotX coding sequence (GTTCAAGTTATGAGGAACACAGG) ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 units/ml RNaseOUT Recombinant Ribonuclease Inhibitor (#10777019; Thermo Fisher Scientific); 0.5 mm Spermidine (#S2626 ...
-
bioRxiv - Immunology 2023Quote: ... wiso embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting the TotM coding sequence (ACTTATCGTAGAAAGTGACCAGG ...
-
bioRxiv - Immunology 2023Quote: Recombinant mAbs were transiently produced in FreeStyle 293F cells (ThermoFisher Scientific) following the protocol detailed by Vink et al (Vink ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 ng/mL human EGF recombinant protein (Life Technologies, Cat: PHG0311), and 100 IU/mL P/S ...
-
bioRxiv - Genetics 2023Quote: ... 50 ng/ml recombinant mouse epidermal growth factor (EGF; Gibco, PMG8041), 100 ng/ml recombinant murine Noggin (PeproTech ...
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% penicillin/streptomycin and 50ng/ml recombinant mouse EGF (Life Technologies) was used for culturing ApcKO colon organoids ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Staining with DYKDDDDK Tag Recombinant Rabbit Monoclonal Antibody (8H8L17, Invitrogen, 701629) at 1:500 dilution was performed in blocking solution at 4℃ for 14 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... recombinant bacmid DNA was generated in DH10Bac cells (Thermo Fisher 10361012), and isolated bacmid DNA was transfected into Sf9 cells (a gift from Yifan Cheng ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/uL human IL-6 recombinant protein (ThermoFisher PHC0066).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... VEGF ligand (recombinant human protein) was ordered from ThermoFisher (CAT: #PHC9391).
-
bioRxiv - Microbiology 2024Quote: ... Treatment with recombinant 10 U/mL human IFNγ (ThermoFisher Scientific RIFNG100) was done at 24 hours post-infection ...
-
bioRxiv - Bioengineering 2024Quote: ... 5250 ng/mL human recombinant IL-6 protein (Invitrogen; Waltham, MA) was added to the experimental group and an equal volume of 1X PBS was added to the control group ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant murine pro-CtsK were expressed in 293-Freestyle cells (ThermoFisher) by transient expression using FectoPRO transfection reagent (Polyplus transfection) ...
-
bioRxiv - Synthetic Biology 2023Quote: All recombinant proteins were produced in Expi293F cells (Thermo Fisher Scientific) by transient transfection ...
-
bioRxiv - Biophysics 2024Quote: ... The recombinant DR2539 was expressed in Escherichia coli BL21 (DE3) (Invitrogen). The cells were grown at 310 K to an OD600 of ≈ 0.6 in Luria-Bertani medium containing 100 µg ml-1 of ampicillin ...
-
bioRxiv - Immunology 2024Quote: ... injections also contained 1 μg of recombinant murine IL-2 (Gibco). PBS was used as vehicle.
-
bioRxiv - Immunology 2024Quote: ... used for recombinant protein production were maintained in FreeStyle (ThermoFisher, #12338026) or Expi293 media (ThermoFisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% penicillin/streptomycin and 50ng/ml recombinant mouse EGF (Life Technologies) was used for culturing colon organoids ...
-
bioRxiv - Immunology 2024Quote: ... Recombinant proteins were diluted in DPBS (Life technologies cat. # 14040-182) (tetNA was diluted to 0.5 µg/ml) ...
-
bioRxiv - Immunology 2020Quote: ... that does not express HLA DR and are Class II major histocompatibility (MHC) antigen negative was maintained in Iscove’s Modified Dulbecco’s Medium (IMDM, Invitrogen) supplemented with 20% FBS ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and any antigen–MS-Hu6 complex was captured by goat anti–human HRP–conjugated IgG (Invitrogen, Catalog # A18805).
-
bioRxiv - Genetics 2020Quote: ... following de-paraffinization the slides were incubated in eBioscience IHC Antigen Retrieval Solution (ThermoFisher; Cat# 00-4955-58) and washed in 1x PBS three times for five minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... The antibody-antigen complex was captured by incubating with lysis buffer prewashed proteinA/G beads (Thermo Fisher Scientific) for 2 h ...
-
bioRxiv - Biochemistry 2020Quote: ... The antigen-antibody complexes were detected using the Pierce ECL chemi-luminescent detection system (Thermo Scientific, Rockford, IL) and visualized on the ChemiDoc XRS+ gel documentation system (Bio-Rad).
-
bioRxiv - Neuroscience 2020Quote: ... The antigen/antibody complex was eluted from beads by boiling in Lane Marker Sample Buffer (#39001, Thermo Fisher) containing β-mercaptoethanol for SDS-PAGE and Western blotting.
-
bioRxiv - Microbiology 2019Quote: ... SV40 T-antigens were detected using (pAb)108 and species-specific AlexaFluor 488 (Life Technologies, Thermo Fisher Scientific) antibodies ...
-
bioRxiv - Microbiology 2020Quote: ... using antigens conjugated to NHS-activated agarose beads (Pierce™ NHS-Activated Agarose Spin Columns, Thermo Fisher Scientific). Antibodies were eluted in 0.1M glycine ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit or sheep antigens were raised in donkey and conjugated to Alexa 488 or Alexa 594 (Molecular Probes, ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... and subjected to heat- induced antigen retrieval using sodium citrate buffer(10 mM, pH 6, ThermoFisher, Waltham, MA) at >80°C ...
-
bioRxiv - Microbiology 2022Quote: Purified F antigens were biotinylated using an EZ-link Sulfo-NHS -LC-Biotinylation kit (Thermo Fisher, cat#A39257) with a 1:1.3 molar ratio of biotin to F ...
-
bioRxiv - Microbiology 2019Quote: ... SV40 T-antigens were detected using (pAb)108 and species-specific AlexaFluor 488 (Life Technologies, Thermo Fisher Scientific) antibodies ...
-
bioRxiv - Molecular Biology 2021Quote: ... The antiserum was affinity-purified using the peptide antigen coupled to UltraLink™ Iodoacetyl gel (Thermo Fisher Scientific).
-
bioRxiv - Developmental Biology 2022Quote: ... after dewaxing and antigen retrieval non-specific antibody binding was minimised by incubating sections in CAS Block (Invitrogen). Primary antibodies were diluted in Dako antibody diluent (S0809 ...
-
bioRxiv - Plant Biology 2022Quote: ... Chemiluminescence detection of antigen-antibody complexes was carried out with SuperSignal West Femto Western substrate (Thermo Fisher Scientific). As a loading control ...
-
bioRxiv - Neuroscience 2023Quote: ... Antibody/antigen mixture was incubated with Dynabeads M-280 sheep anti-rabbit or mouse IgG (Thermo Fisher Scientific) for 6h at 4°C in the following day ...
-
bioRxiv - Biophysics 2023Quote: ... 200 μL of the virus dilution containing 1µg-3µg p24 antigen was transferred to a poly-D-lysine coated glass coverslip (#1 chambered coverglass, Nunc™ Lab-Tek™ ...
-
bioRxiv - Neuroscience 2023Quote: ... For antigen retrieval cells were incubated for ten minutes with 1 ug/ml proteinase K (Thermo Fisher Scientific) at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... and coronavirus antigens were expressed in Expi293F cells by transient transfection in FreeStyle F17 expression media (Thermo Fisher) supplemented to a final concentration of 0.1% Pluronic Acid F-68 and 20% 4 mM L-glutamine using Expifectamine transfection reagent (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the antigens were captured for 15 mins at 4 °C with 50 µl Streptavidin Magnetic beads (Thermo Fisher) which were previously incubated with superblock (Thermo Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... Target antigens were finally detected using SuperSignal™ West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific, Waltham, MA). Images were scanned and analyzed using ImageJ software ...
-
bioRxiv - Plant Biology 2019Quote: ... The recombinant enzymes were probed using anti-V5-HRP conjugated antibody (Invitrogen), which was detected using an ECL Advance Western Blotting Detection Kit (Amersham ...
-
bioRxiv - Immunology 2021Quote: ... and recombinant proteins were purified using Ni-NTA agarose (Thermo Fisher Scientific), then buffer-exchanged into PBS and concentrated using Amicon Ultra centrifugal filters (MilliporeSigma) ...
-
bioRxiv - Molecular Biology 2020Quote: Recombinant 6x-His tagged PTB was purified using Ni-NTA agarose (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Recombinant BUD13 purification was confirmed by SimplyBue SafeStain (Thermo Fisher Scientific, LC6060) and western blot using BUD13 antibody (Bethyl Laboratories ...
-
bioRxiv - Immunology 2021Quote: All recombinant proteins were expressed and purified using Expi293F cells (Life Technologies,) as described in detail previously [34 ...
-
bioRxiv - Immunology 2019Quote: ... slices were overlaid with 50ng recombinant IL-15/IL-15Rαcomplex (Thermo Fisher) in 10□1 of cRPMI following peptide treatment ...
-
bioRxiv - Biochemistry 2019Quote: ... Recombinant virus was made by co-transfection into SF9 insect cells (Invitrogen) of the plasmid and BacVector3000 baculovirus DNA (Novagen ...