Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for Dengue Virus Serotype 2 NS1 Protein HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: HEK293 cells were maintained in Dulbecco’s Modified Eagle’s Medium (Invitrogen) with 5% (v/v ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cells were maintained in DMEM (Thermo Fisher Scientific, 10569010) supplemented with 10% FBS and penicillin/streptomycin ...
-
bioRxiv - Neuroscience 2019Quote: HEK293 cells or FreeStyle 293F cells (Invitrogen, Waltham, MA, USA) were cultured in DMEM medium with 10% FBS and 1% Pen-Strep at 37°C with 5% CO2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and pHelper62 into HEK293 cells using Lipofectamine LTX (Invitrogen 15338030) following standard protocols62 ...
-
Structural investigation of ACE2 dependent disassembly of the trimeric SARS-CoV-2 Spike glycoproteinbioRxiv - Biophysics 2020Quote: ... The construct was transiently transfected into HEK293 cells (Thermo Fisher) with PEI MAX (Polysciences ...
-
bioRxiv - Neuroscience 2020Quote: HEK293 cells were maintained in DMEM (High Glucose DMEM; Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Molecular Biology 2021Quote: HEK293 Flp-In T-Rex cells (Thermo Fisher Scientific, R78007) were cultured in DMEM + GlutaMAX-I (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... HEK293 was grown in DMEM (Thermo Fisher, USA, Cat# 11995065) supplemented with 10% FBS (HyClone ...
-
bioRxiv - Cancer Biology 2020Quote: ... VCaP and HEK293 were grown in DMEM with Glutamax (Gibco); LNCaP ...
-
bioRxiv - Molecular Biology 2021Quote: Flp-In™ T-REx™ HEK293 parental cells (Invitrogen) were seeded at 1×106 cells per 10 cm culturing dish in 15 ml media (DMEM High Glucose ...
-
bioRxiv - Immunology 2020Quote: ... HEK293 cells were maintained in DMEM (Thermo Fisher cat. 11965) supplemented with 10% FBS ...
-
bioRxiv - Biochemistry 2021Quote: 0.3×106 HEK293 cells in DMEM media (Gibco #31966-021) supplemented with 10% fetal bovine serum were seeded in each well of 12-well plates ...
-
bioRxiv - Biochemistry 2021Quote: HEK293 cells were cultured in Dulbecco’s modified Eagle medium (Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Biochemistry 2021Quote: ... Dulbecco’s Modified Eagle’s Medium for HEK293 cells) (Gibco, Thermofisher Scientific) containing 10% (v/v ...
-
bioRxiv - Biochemistry 2021Quote: ... Dulbecco’s Modified Eagle’s Medium for HEK293 cells) (Gibco, Thermofisher Scientific) containing 10% (v/v ...
-
bioRxiv - Molecular Biology 2021Quote: HEK293-6E cells were transfected using 293fectin protocol (Thermo Fisher). The SIRT6 biosensors were expressed using mammalian expression vector pTT5 (National Research Council ...
-
bioRxiv - Microbiology 2021Quote: ... and RaTG13 RBD were produced using HEK293-F cells (Invitrogen) cultivated in suspension using Freestyle medium (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... HEK293 and COS-7 cells and Lipofectamine 2000 (Thermo Fisher) reagent for NIH3T3 cells ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were maintained in DMEM (Gibco™, #31966-021) supplemented with 10% FBS and 1X Non-essential Amino Acid supplement (Sigma ...
-
bioRxiv - Physiology 2022Quote: ... HEK293 were cultured in Dulbecco’s Modified Eagle Medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS; ...
-
bioRxiv - Neuroscience 2023Quote: HEK293 cells were cultured in Dulbecco’s modified Eagle’s medium (Gibco) supplemented with 10% fetal bovine Serum (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: HEK293 cells were cultured in Gibco DMEM (ThermoFisher Scientific, 10566024) supplemented with 10% FBS at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2022Quote: ... HEK293 cells stably expressing the ecdysone receptor (EcR-293; Invitrogen), and derived cell lines stably expressing GFP-tagged wild-type or dominant negative (E228Q ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK293 transfections were performed with Lipofectamine 2000 reagent (ThermoFisher, #11668019) according to standard procedures and the cells expressing SorLA mutants and TNFα-GFP (or GFP ...
-
bioRxiv - Molecular Biology 2023Quote: HEK293 cells were grown in Dulbecco’s modified Eagle’s medium (Gibco) supplemented with 10% fetal bovine serum ...
-
bioRxiv - Systems Biology 2023Quote: HEK293 cells were grown and maintained in DMEM (Thermo Fisher), supplemented with 10% FBS (PAN-Biotech) ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 and Hela cells were cultured in DMEM media (Invitrogen) supplemented with 10% FBS (Sigma) ...
-
bioRxiv - Developmental Biology 2023Quote: ... HEK293 and P19 cells were transfected by Lipo2000 (Invitrogen, 11668500) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... suspension HEK293 host cell line (Freestyle 293-F, ThermoFisher Scientific) was grown in Freestyle 293 expression medium (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 Flp-In™ T-REx™ cells (Thermo Fisher) were co-transfected with the final plasmid and the pOG44 plasmid (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... was transduced into HEK293 cells using Lipofectamine LTX (Invitrogen-ThermoFisher) to knock out PML by the CRISPR-Cas9 system ...
-
bioRxiv - Cell Biology 2023Quote: ... was transduced into HEK293 cells using Lipofectamine LTX (Invitrogen-ThermoFisher) to knock out PML by the CRISPR-Cas9 system ...
-
bioRxiv - Neuroscience 2023Quote: HEK293 and GL261 cells were cultured in DMEM (Gibco, #31885) with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2023Quote: ... GKO HEK293 cells were maintained in DMEM (Gibco Cat# 11995065) containing 10% FBS (Gibco Cat# 16000044) ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293 Flp-In T-Rex cells (Thermo Fisher Scientific, R78007) were transfected with pcDNA5/FRT/TO-GFP (see below ...
-
bioRxiv - Molecular Biology 2023Quote: HEK293 Flp-In T-REx cells (Thermo Fisher Scientific, R78007) with SBP-tagged eIF4A1 integrant 15 were seeded in a 10-cm dish and cultured for 3 d in the presence of 1 μg/ml tetracycline ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK293 in Dulbecco’s modified Eagle Medium (DMEM, Life Technologies #11965118); T-47D in Roswell Park Memorial Institute (RPMI ...
-
bioRxiv - Cell Biology 2023Quote: Flp-In™ T-REx™ HEK293 cells (Invitrogen, R78007) containing a single genomic FRT site and stably expressing the Tet repressor were cultured in DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Systems Biology 2023Quote: ... HEK293 cell lines were lifted using TrypLE Express (Thermo Fisher) and resuspended in media supplemented with the appropriate volume of cADDis BacMam ...
-
bioRxiv - Neuroscience 2023Quote: HEK293 cells were transfected with the NeonTM transfection kit (Invitrogen) according to the manufacturer’s description ...
-
bioRxiv - Cell Biology 2024Quote: Flp-In T-Rex HEK293 cells (Invitrogen, Thermo Fisher Scientific) were co-transfected with plasmids pOG44 (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: Flp-In T-Rex HEK293 cells (Invitrogen, Thermo Fisher Scientific) were co-transfected with plasmids pOG44 (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... HEK293 GnTI- cells were cultured in Freestyle 293 medium (Invitrogen) supplemented with 2% FBS on a shaker at 37 °C in the presence of 8% CO2 to a density of 3 × 106 cells per ml ...
-
bioRxiv - Biochemistry 2024Quote: ... GKO HEK293 cells were maintained in DMEM (Gibco Cat# 11995065) containing 10 % FBS (Gibco Cat# 16000044) ...
-
bioRxiv - Cell Biology 2024Quote: FlpIn CHO and HEK293 cell lines were purchased from Invitrogen and maintained in Dulbecco’s Modified Eagle’s Medium supplemented with 5% Foetal Bovine Serum (ThermoFisher Scientific (Gibco) ...
-
bioRxiv - Developmental Biology 2024Quote: HEK293 cells were transfected using Lipofectamine 3000 (Invitrogen, Cat# L3000008) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Flp-In T-Rex HEK293 cell lines (Thermo Fisher Scientific) expressing mitochondrial-relocated golgin-BirA* fusions (from John Shin ...
-
bioRxiv - Neuroscience 2023Quote: ... Stable HEK293 lines were generated by lipofection (Lipofectamine 2000, ThermoFisher) of ∼80% confluent cells with 2 µg of linearized expression plasmid overnight according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1μl of sample was mixed in 20μl final of SoFast-Green reaction mix containing 10nM of forward (CCGTCTTAAGTTTGATTTT) and reverse (AGAGGTGGACCAACTCGGTA) primers for MVMp NS1 gene amplification using the StepOnePlus real-time PCR system (Thermo Fisher Scientific). Primers targeting the 18S gene were used for normalization (forward ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 μl Dynabeads Protein G (Thermo Fisher Scientific, 10004D), and 400 μl dilution buffer (20 mM Tris-HCl pH 8.0 ...