Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for D Ribitol 5 Phosphate Cytidylyltransferase ISPD CRPPA Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... D-ribose and ribitol were analyzed with high pressure ion chromatography (HPIC) Dionex ICS-6000 (Thermo Fisher Scientific) with CarboPac PA20 column (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... in Dulbecco’s Phosphate-Buffered Saline (D-PBS) (Gibco) to 1 x 106 cells/mL ...
-
bioRxiv - Microbiology 2020Quote: ... The enzymatic activity of Ddl was also assayed by measuring the release of inorganic phosphate in the reaction (similar to the D-ala-D-ala dipeptide formation assay) with EnzChek phosphate assay kit (Life Technologies). 10 μl of the reaction product was added to 790 μl of standard reaction mixture containing 230 μl dH2O ...
-
bioRxiv - Microbiology 2024Quote: ... and 5% tryptose phosphate broth (Gibco). For virus infections ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml phosphate buffered saline (PBS, ThermoFisher) followed by 40 ml 4% paraformaldehyde (PFA ...
-
bioRxiv - Biophysics 2024Quote: ... diluted in Dulbecco’s phosphate-buffered saline D-PBS (+/+) (#14040141, Gibco) and stored at 4°C.
-
bioRxiv - Microbiology 2022Quote: ... and 5% tryptose phosphate broth (Thermo Fisher #18050039). BHK21/WI-2 cells (Kerafast #EH1011 ...
-
bioRxiv - Bioengineering 2024Quote: ... 20 µ L Dulbecco’s Phosphate-Buffered Saline (D-PBS) (14190094, Gibco) was added to all the middle channel inlets and the OrganoPlate® was placed in a humidified incubator at 37 °C and 5% CO2 overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cultured neurons were transfected with plasmids (1.5 μg of plasmid DNA per well) at 4 - 5 d in vitro (DIV) using a commercial calcium phosphate transfection kit (Thermo Fisher Scientific) as previously described21,24.
-
bioRxiv - Molecular Biology 2022Quote: ... Cells we washed with Dulbecco’s phosphate buffered saline (D-PBS, Life Technologies) and dissociated with 0.05% Trypsin-EDTA (Life Technologies) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mL of Phosphate-Buffered Saline (PBS; Gibco, ThermoFisher Scientific) was added to reduce viscosity ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mL of Phosphate-Buffered Saline (PBS; Gibco, ThermoFisher Scientific) was added to reduce viscosity ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and rinsed 3 times with Dulbecco’s phosphate buffer saline (D-PBS) (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... Antibodies were NKX2-5 (mouse, R&D, 1:500) and β -actin (rabbit, Invitrogen, 1:1000). Subsequently ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µM Cytochalasin D (ThermoFisher, Waltham, MA)] was added to resuspend the pellet (P) ...
-
bioRxiv - Pathology 2023Quote: ... Synovial membranes were rinsed with Dalbeco-phosphate-buffered saline (D-PBS, Thermo Fisher Scientific, JPN) and minced with MEM-α containing 3 mg/mL collagenase V (FUJIFILM Wako Pure Chemical CO. ...
-
bioRxiv - Biochemistry 2024Quote: ... and Assay Buffer 3: Dulbeccòs phosphate buffer saline (D-PBS) pH 7.4 (Gibco 14040-133). In parallel ...
-
bioRxiv - Synthetic Biology 2021Quote: Custom DNA oligonucleotides with 5’ phosphate modifications were ordered from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Control (vehicle: 40 μM HCL, 0.002% BSA [0-5 d]; 0.1% DMSO [5-10 d]; all from Thermo Fisher Scientific) for 0-10 d [=Baseline] ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mMand 33 mM D-glucose (Gibco, USA) were added to the medium for 48 h ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 μM cytosine-A-D-arabinofuranoside (AraC; Gibco) was added to cultures for 12 h ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Developmental Biology 2023Quote: Pyridoxine (PN, Fisher BioReagents, 1mM) and pyridoxal 5′-phosphate (PLP, Thermo Scientific, 1mM) were dissolved in water and added to E ...
-
bioRxiv - Genomics 2023Quote: ... washed them 3X with 5 mL dPBS (Dulbecco’s Phosphate Buffered Saline, Gibco, UK), treated them with Lysis Buffer ...
-
bioRxiv - Microbiology 2024Quote: ... membranes were blocked with 5% milk in phosphate-buffered saline (PBS [Gibco, 21600010])-T (PBS with 0.05% Triton X-114 [Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... membranes were blocked with 5% milk in phosphate-buffered saline (PBS [Gibco, 21600010])-T (PBS with 0.05% Triton X-114 [Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... 5-fluorocytosine (100 mg/kg/d; diluted in sterile saline; 5-FC; ThermoFisher) was used in combination with PEA (0.5 mg/kg/d ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Immunology 2023Quote: ... cells were incubated with 5 µM Cytochalasin D (Thermofisher) 1 hour prior to experiments and during experiments.
-
bioRxiv - Microbiology 2020Quote: ... cell lines were washed thrice using Dulbecco’s phosphate buffered saline (D-PBS) without calcium and magnesium (Gibco) and harvested with TrypLE™ express enzyme (1X ...
-
bioRxiv - Cancer Biology 2022Quote: Day (D) 13-14 differentiated CD34+-derived human megakaryocytes were washed in Phosphate-Buffered Saline (PBS, Gibco), and then resuspended as previously described to study agonist responsiveness30 ...
-
bioRxiv - Microbiology 2023Quote: ... Plates were then blocked with a 5% powdered milk phosphate buffered saline (PBS) (ThermoFisher) solution for at least 1 hour at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... to obtain 5’ phosphate ends for subsequent ligations and passed through NucAway columns (Ambion) to remove RNAs <20 nt in length ...
-
bioRxiv - Microbiology 2024Quote: ... the lungs were gently flushed with 2 × 0.5 ml of sterile Dulbecco’s Phosphate Buffered Saline (D-PBS, Gibco) through trachea cannulation ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 mg·mL-1 in acetone diluted 1:250 in Dulbecco’s phosphate-buffered saline (DPBS, ThermoFisher) and propidium iodide (PI ...
-
bioRxiv - Neuroscience 2022Quote: ... dissolved in a vehicle solution of 5% ethanol in phosphate-buffered saline (PBS; Fisher Scientific), as described32,33 ...
-
bioRxiv - Immunology 2024Quote: ... for 5 minutes at 4°C before quenching in 1x Phosphate Buffered Saline (PBS; Gibco). Cell viability was quantified by staining with Acridine Orange/Propidium Iodide at a 1:1 dilution in a Cellometer slide before reading on an Auto2000 Cellometer (Nexcelom Biosciences ...
-
bioRxiv - Immunology 2021Quote: All antibody staining of live cells was performed in phosphate buffered saline (Gibco) with 1-2% FBS ...
-
bioRxiv - Microbiology 2020Quote: Monoclonal antibody samples were serially diluted in Dulbecco’s Phosphate-Buffered Saline (DPBS, Gibco) using half-log dilutions starting at a concentration of 50 μg ml-1 ...
-
MK2 deficiency decreases mortality during the inflammatory phase after myocardial infarction in micebioRxiv - Physiology 2023Quote: ... Mouse monoclonal antibodies against GAPDH (glyceraldehyde 3-phosphate dehydrogenase) (# 4300) were from Ambion. Secondary antibodies conjugated with horseradish peroxidase were from Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: ... RAW 264.7 cells were stimulated with the ID8 cell-derived CM supplemented with 5 μg/mL of IL-18 neutralizing antibody (R&D, Minneapolis, MN, USA) or 5 μg/mL of rat IgG1 Isotype as a control (Thermo-Fisher Scientific).
-
bioRxiv - Biochemistry 2022Quote: Prion-infected brain homogenate was prepared by homogenizing 30 brains from female C57Bl/6 mice terminally-infected with the ME7 prion strain in Dulbecco’s phosphate buffered saline lacking Ca2+ or Mg2+ ions (D-PBS; Gibco) to produce a pool of 130 ml 10% (w/v ...
-
bioRxiv - Biochemistry 2021Quote: Prion-infected brain homogenate was prepared by homogenizing 200 brains from CD-1 mice terminally-infected with the RML prion strain in Dulbecco’s phosphate buffered saline (D-PBS; Gibco) to produce a pool of ~1 litre 10 % (w/v ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and rinsed 3 times with Dulbecco’s phosphate buffer saline (D-PBS) (Thermo Fisher Scientific, Invitrogen #14190169, Waltham, MA, USA). Then ...
-
bioRxiv - Immunology 2024Quote: ... followed by administration of pertussis toxin (PTX, 121 ng/mouse) in Dulbecco’s phosphate buffered saline (D-PBS, 14190-094; Gibco), first on the day of immunization and then again 24 h later ...
-
bioRxiv - Neuroscience 2024Quote: ... and euthanized by intracardiac perfusion with ice-cold heparinized (10k U / L; Sagent Pharm. 25021-403-04) Dulbecco’s phosphate-buffered saline (D-PBS; 14190136; ThermoFisher). Each brain was removed ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 mg/mL D-glucose and 10 mM HEPES (Invitrogen, #15630056) at 36°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5-Dodecanoylaminofluorescein Di-β-D-Galactopyranoside (C12FDG, cat#D2893 from ThermoFisher) was added to a final working concentration of 16,66 nM for 30 min at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... Cell counts at 5 d were determined by trypan blue (Gibco); cell counts at 12 d and 19 d were determined by ViaStain Acridine Orange/Propdium Iodide Staining Solution (Nexcelom).
-
bioRxiv - Biochemistry 2024Quote: ... 5-(Pentafluorobenzoylamino) Fluorescein Di-β-D-Glucopyranoside (PFB-FDGlu, ThermoFisher Scientific) was used to evaluate GCase activity in live cells ...