Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for Caspase Recruitment Domain Family Member 17 CARD17 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... and an ICAM1 exon 2 (Ig domain 1)-targeting TrueGuide sgRNA (Invitrogen; sequence: CCACAGTTCTCAAAGCACAG) according to the manufacturer’s U2OS protocol ...
-
bioRxiv - Molecular Biology 2020Quote: Anti-CD15-APC (Thermal Fisher Scientific, Cat. No. 17-0158-42), anti-CD14-FITC (Thermal Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... HEK293T/17 were transfected using Lipofectamine 2000 (Invitrogen, Breda, The Netherlands) with 4:2:1 ratio of lentiCRISPRv2:PAX2:VSV-G ...
-
bioRxiv - Bioengineering 2021Quote: ... the mixture was purified by centrifuge (accuSpin Micro 17, Thermo Fisher) at 10,000 rpm for 10 min and repeated twice to remove unbounded biotinylated nanobodies ...
-
bioRxiv - Bioengineering 2021Quote: ... the AuNP assay colloid was centrifuged (accuSpin Micro 17, Thermo Fisher) at 3,500 rpm (1,200×g ...
-
bioRxiv - Cell Biology 2021Quote: ... and/or APC-CD41(1/100, MWReg30, ThermoFisher, 17-0411-82). A Polyclonal rat anti-mouse GPIb antibody(Emfret ...
-
bioRxiv - Cell Biology 2022Quote: ... EpCam-APC (1:500, Thermo Fisher Scientific Cat# 17-5791-82); cKit-PE (1:500 ...
-
bioRxiv - Immunology 2021Quote: ... phospho-S6 APC Ser235/236 (Invitrogen 17-9007-42, 1:80), Bcl-6 FITC (Biolegend 358513 ...
-
bioRxiv - Immunology 2022Quote: ... Cxcr5-APC (1:50; clone SPRCL5; ThermoFisher Cat. 17-7185-82); CD19:APC (1:200 ...
-
bioRxiv - Immunology 2022Quote: ... APC αTCRγδ (Cat#17-5711-82, ebioscience/Invitrogen Santa Clara, CA), ACP αPD1 (Cat# 562671 ...
-
bioRxiv - Biochemistry 2019Quote: ... and stained with SYTO 17 red fluorescent nucleic acid stain (Invitrogen) at a final concentration of 10 nM for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... anti-CD127 (No. 17-1273; eBioscience/Affymetrix, Santa Clara, CA, USA), anti-CD8 (No ...
-
bioRxiv - Molecular Biology 2020Quote: ... separated in 17% Urea gel and stained with SYBR Gold (Invitrogen). Gel slices containing nucleic acids 27 to 30 nucleotides long were excised and incubated in a thermomixer with 0.3 M NaCl at 4°C overnight with constant agitation to elute RNA ...
-
bioRxiv - Immunology 2021Quote: ... with 17 ng/ml of recombinant human IL-2 (ThermoFisher Scientific). MART-1-specific CD8+ T-cell clones were generated by Friedmann et al (Friedmann et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... CD7/APC (clone GP40 [Leu-9], Invitrogen, cat. 17-0079-42), Fixable Viability Stain 700 (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... and anti-CD25-APC (Invitrogen 17-0251-81: Clone: PC61.5, eBioscience), and then were purified as DAPI- ...
-
bioRxiv - Developmental Biology 2023Quote: ... for 15-17 hours in TNTx (Tris-HCl pH 8.0 - Invitrogen 15567-027 ...
-
bioRxiv - Cell Biology 2023Quote: ... F4/80 (clone BM8, Thermo Fisher Scientific Cat# 17-4801-80), Live/Dead Aqua or Violet fixable stains (Life ...
-
bioRxiv - Cancer Biology 2024Quote: ... HEK293T/17 cells (ATCC) in phenol red free OPTI-MEM (Gibco) were co-transfected with a construct of interest and packaging plasmids Gag-Pol 8.91 (Addgene #187441 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and APC anti-EpCAM (Invitrogen, Clone G8.8, Cat# 17-5791-80) at 1:100 dilution ...
-
bioRxiv - Neuroscience 2024Quote: ... and Rat IgG2a Isotype Control-APC (Thermofisher Scientific, 17-4321-81) were added to the antibody panel ...
-
bioRxiv - Genomics 2024Quote: ... was dissolved in HPLC grade ethanol (Fisher Scientific, 64-17-5) to a final concentration of 30,000μg/mL and complexed to fatty acid-free (FAF ...
-
bioRxiv - Immunology 2019Quote: ... CellEvent® Caspase-3/7 Green Detection Reagent (Thermal Fisher Scientific, C10423); CellTrace™ Violet (Thermo-Fisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... and rabbit anti-activated Caspase-3 (Fisher Scientific/BD, BDB559565, 1:500). Antibody used for fluorescent in situ hybridization was mouse anti-Dig (Jackson ImmunoResearch 200-002-156 ...
-
bioRxiv - Cancer Biology 2021Quote: ... CellEvent™ Caspase-3/7 Green live staining detection reagent (Thermofisher Scientific) at 2 μM was prepared and added to the epithelial and vascular channels in order to visualize an apoptotic T-cell killing response ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µM CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher Scientific) were applied for monitoring effector caspase activation and 2.5 µM AlexaFluor647 hydrazide for detecting cell lysis.
-
bioRxiv - Cancer Biology 2021Quote: ... at 1:500 dilution and caspase-10 (Thermo Fisher Scientific, PA5-29649) at a 1:1000 dilution in LICOR buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... CellEvent Caspase 3/7 Green Detection Reagent was obtained from Thermo Fisher Scientific and used according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2023Quote: ... Apoptosis was assessed using the CellEvent Caspase-3/7 Detection Reagent (Invitrogen) over TCB-treatment duration or at specific intervals ...
-
bioRxiv - Neuroscience 2021Quote: ... and P0 were incubated for 15 minutes at room temperature with antibodies to Thy1 (also known as CD90) and L1CAM pre-conjugated to the fluorophores APC (ThermoFisher Scientific#17-0902-82) and PE (Miltenyi Biotec 130-102-243) ...
-
bioRxiv - Cell Biology 2023Quote: ... Muscles were minced with a sterile razor blade and transferred into digestion medium containing collagenase II and dispase II (Fisher Scientific, 17-101-015; 17-105-041) for enzymatic dissociation of mononuclear cells from muscle fibers in a rotating water bath at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: Constructs encoding harmonin domains were cloned in the pDEST17-vector (Gateway cloning system, Invitrogen, USA). The cDNAs encoding C-terminal tails of Mm JAM-B tail (amino acids 257-299) ...
-
bioRxiv - Bioengineering 2022Quote: ... a C-terminal gp160 trimerization domain and SnoopTagJr) were expressed in suspension Expi293F (Thermo Fisher) and ExpiCHO-S cells respectively and purified as described above for DogCatcher-RBD.
-
bioRxiv - Molecular Biology 2020Quote: ... Plus3 domain point mutations were introduced using the Phusion Site-Directed Mutagenesis kit (ThermoFisher Scientific) and verified by sequencing.
-
bioRxiv - Biochemistry 2023Quote: ... and cDNA encoding GH1D1 domain was subcloned to a modified pET-32a vector (Invitrogen, USA) with an N-terminal TrxA tag and a 6×His tag followed by a TEV protease recognition site ...
-
bioRxiv - Biophysics 2023Quote: Lphn3 GAIN domain constructs were expressed in Expi293 human embryonic kidney cells (Thermo Fisher, A14527) in suspension culture in Expi293 media (Thermo Fisher ...
-
bioRxiv - Immunology 2024Quote: The bacterial codon-optimized coding sequence of ZBP1-Zα1Zα2 domains was synthesized (Thermo Fisher Scientific) and subcloned into N terminally His-Tagged pNIC-ZB vector ...
-
bioRxiv - Genetics 2021Quote: ... cells were grown in 2x YPD media (Fisher Scientific, DF0427-17-6) supplemented with 80 mg/L of adenine hemisulfate ...
-
bioRxiv - Neuroscience 2021Quote: ... the blood was spun in an accuSpin Micro 17 microcentrifuge (Fisher Scientific) at 3000 rpm for 8 min ...
-
bioRxiv - Neuroscience 2019Quote: ... HEK293T-17 cells were grown in DMEM (Thermo Fisher Scientific, Cat #11965092) supplemented with 10% (vol/vol ...
-
bioRxiv - Pathology 2022Quote: ... APC-conjugated anti-CD115 (Invitrogen, clone AFS98, #17-1152-82, 1/100), BV650-conjugated anti-Gr-1 (Biolegend ...
-
bioRxiv - Developmental Biology 2022Quote: ... APC anti-mouse CD31 (PECAM-1) (Thermo Fisher Scientific, 17-0311-82), PE Rat IgG2α (BD Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... Cells were then stained with anti-CD3-APC (Invitrogen, #17-0032-82), anti-CD4-PerCP-Cy5.5 (Biolegend ...
-
bioRxiv - Physiology 2021Quote: ... 17] in Minimal Essential Media with Earl’s salts (Gibco; Gaithersburg, MD USA) plus 10% FBS and 1% penicillin/streptomycin (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... Embryos were fixed with 17% formaldehyde/heptane (ThermoFisher Scientific, Waltham, MA, USA) for 20 min followed by methanol or ethanol devitellinization ...
-
bioRxiv - Cell Biology 2021Quote: ... Embryos were fixed with 17% formaldehyde/heptane (ThermoFisher Scientific, Waltham, MA, USA) for 20 min followed by methanol devitellinization ...
-
bioRxiv - Microbiology 2020Quote: ... and premixed Difco™ ISP4 dehydrated medium (Fisher Scientific, #DF0772-17-7)) ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK-293T/17 cells were co-transfected using Lipofectamine 2000 (Life Technologies) with MLV Gag-Pol packaging construct and the MLV transfer vector encoding a luciferase gene reporter either by itself (MLV-control ...
-
bioRxiv - Pathology 2023Quote: ... or the APC isotype control (Thermo Scientific, #17-4714-42, 5 μL) was added to their respective samples tubes at concentrations recommended by the manufacturer ...
-
bioRxiv - Bioengineering 2023Quote: ... HEK293T/17 cells were cultured in Dulbecco’s Minimum Essential Medium (DMEM, ThermoFisher) supplemented with 10% fetal bovine serum (FBS ...