Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Canine Parvovirus 2 VP2 Capsid Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Porcine parvovirus [PPV] (VetMAX™ Porcine Parvovirus Kit, Thermo Fisher Scientific, MA, USA), PEDV ...
-
bioRxiv - Genetics 2021Quote: ... dataset contained 423 subjects from 37 breeds genotyped for ∼45,000 SNPs (Affymetrix v.2 Canine array)15 ...
-
bioRxiv - Microbiology 2024Quote: ... and TNF-α Canine ELISA Kit (# ECTNF, Invitrogen) were used to measure IL-8 and TNF-α ...
-
bioRxiv - Microbiology 2024Quote: ... The IL-8 Canine ELISA Kit (#ECCXCL8, Invitrogen) and TNF-α Canine ELISA Kit (# ECTNF ...
-
bioRxiv - Microbiology 2021Quote: ... For immunofluorescence analysis the cells were fixed as described above and stained with a monoclonal mouse antibody against the viral capsid proteins followed by staining with a goat anti-mouse IgG Alexa Fluor 488 (Invitrogen).
-
bioRxiv - Biochemistry 2022Quote: ... affinity-purified polyclonal rabbit anti-MVV capsid/p24 antibody (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Quantification of VP2 particles was determined by absorbance at A280 with NanoDrop (NanoDrop2000, Thermo Fisher Scientific), as well as by comparison to a reference B19V sample on a dot blot.
-
bioRxiv - Microbiology 2023Quote: ... Quantification of VP2 particles was determined by absorbance at A280 with NanoDrop (NanoDrop2000, Thermo Fisher Scientific) and by comparison to a reference BSA sample on SDS-PAGE ...
-
bioRxiv - Microbiology 2021Quote: ... Madin-Darby Canine Kidney (MDCK) cells were maintained in DMEM (Invitrogen), containing 10% (v/v ...
-
bioRxiv - Microbiology 2022Quote: ... Capsids were digested with 3 mg/mL proteinase K (Fisher Scientific: BP1700) in 100 mM KCl ...
-
bioRxiv - Microbiology 2023Quote: ... First Goat anti-Canine IgG biotin (Thermo Scientific™, Waltham, MA, USA) was added to the fox and wolf samples and antiferret IgG biotin (Merck ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cleared lysates containing AAV capsids were purified by AVB Sepharose (Thermo Fisher) in the case of AAV1 ...
-
Dual signaling via interferon and DNA damage response elicits entrapment by giant PML nuclear bodiesbioRxiv - Microbiology 2021Quote: ... Capsids and PML cages were segmented manually in Avizo 9.4.0 (Thermo Fisher Scientific). Videos were generated with Avizo 9.4.0 or ImageJ and processed with VSDC Video Editor.
-
bioRxiv - Microbiology 2024Quote: ... Phage capsids were digested by adding 4 μl of proteinase K (Thermo Scientific) and incubating for 1 h at 60 °C ...
-
bioRxiv - Cell Biology 2020Quote: Madin-Darby canine kidney (MDCK) strain II was cultured in DMEM medium (Invitrogen) supplemented with 10% FBS (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: The Madin-Darby canine kidney (MDCK) cell line was maintained in DMEM (Gibco) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Microbiology 2022Quote: ... 22.5 μL capsid suspension was supplemented with 2.5 μL 1% SYPRO orange dye (Invitrogen) and subjected to DSF in a Bio-Rad CFX96 qPCR instrument ...
-
bioRxiv - Microbiology 2021Quote: Madin-Darby Canine Kidney (MDCK) cells (ATCC) were maintained in DMEM (Gibco-Invitrogen, Inc.) supplemented with 10% foetal bovine serum (Biosera ...
-
bioRxiv - Microbiology 2021Quote: Madin-Darby Canine Kidney (MDCK) cells (ATCC) were maintained in DMEM (Gibco-Invitrogen, Inc.) supplemented with 10% foetal bovine serum (Biosera ...
-
bioRxiv - Microbiology 2023Quote: ... Madin-Darby Canine Kidney (MDCK) cells (ATCC) were maintained in DMEM (Gibco-Invitrogen, Inc.) supplemented with 10% foetal bovine serum (Biosera ...
-
bioRxiv - Microbiology 2023Quote: ... Madin-Darby Canine Kidney (MDCK) cells (ATCC) were maintained in DMEM (Gibco-Invitrogen, Inc.) supplemented with 10% foetal bovine serum (Biosera ...
-
bioRxiv - Biophysics 2022Quote: Recombinant plasmid pFB1-VP2 carrying the mutation D263A in VP2 of MVMp was used as a donor to construct the corresponding BM-VP2 bacmid using the baculovirus expression system (Invitrogen) (Reguera et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... The original DNA concentration of VP2 was determined using the NanoDrop ND-1000 (Thermo Fisher Scientific Inc., Waltham, MA, USA) and diluted to 1×107 copies/μL.
-
bioRxiv - Molecular Biology 2021Quote: ... Madin-Darby canine kidney cells (MDCK) were cultured in Glasgow’s Modified Eagle Medium (GMEM; Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2019Quote: Mardin-Darby Canine Kidney cells (MDCKs) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (Gibco) supplemented with L-glutamine and 10% Fetal Calf Serum ...
-
bioRxiv - Microbiology 2022Quote: Madin-Darby canine kidney (MDCK) cells were cultured in Dulbecco’s modified Eagle medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Microbiology 2022Quote: Madin-Darby canine kidney (MDCK) cells were maintained in minimal essential medium (MEM) (Gibco, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Bioengineering 2023Quote: ... and recombinant human interleukin-2 (IL-2) protein (Invitrogen) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... fixed in 4% paraformaldehyde and stained with a primary mouse monoclonal antibody raised against IBDV VP2 [18] and a secondary goat anti-mouse antibody conjugated to Alexa Fluor 488 (Thermo Fisher Scientific). Wells were marked positive or negative for the presence or absence of virus by immunofluorescence microscopy and the TCID50/mL calculated by the Reed and Muench method [19] ...
-
bioRxiv - Microbiology 2021Quote: Recombinant B19 virus-like particles (VLPs) consisting of VP2 were produced using the ExpiSf™ Expression System Starter Kit (Thermo Fisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: Recombinant B19 virus-like particles (VLPs) consisting of VP2 were produced using the ExpiSf™ Expression System Starter Kit (Thermo Fisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The MSCV vector was produced by transfecting MSCV-VP2 IRESeGFP and VSV-G into 293GP cells using the Lipofectamine 3000 reagent (Thermo Fisher Scientific). At 48 hours after the transfection ...
-
bioRxiv - Systems Biology 2024Quote: ... VP4:VP2-complemented CVB3 A67G was prepared by transfecting HEK-293T cells with equal molar ratios of pcDNA CVB3 A67G and pcDNA3 VP4:VP2 using Lipofectamine 2000 (Thermo Fisher, 11668019). Viral supernatants were concentrated by ultracentrifugation (100,000 rcf for one hour at 4°C ...
-
bioRxiv - Microbiology 2022Quote: Madin–Darby canine kidney (MDCK) cells were maintained in minimum essential medium (MEM, Thermo Fisher Scientific). African green monkey kidney (Vero ...
-
bioRxiv - Microbiology 2020Quote: ... Madin-Darby Canine Kidney (MDCK) cells were grown in Minimal Essential Medium (MEM)(11430-030, Gibco) containing 5% newborn calf serum (16010-159 ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNAs of canine Tgfα and Nrg1 were synthesized by GeneArt (Thermo Fisher Scientific, Waltham, MA). The cDNA sequences of the cloned growth factors are shown in the supplementary table and note.
-
bioRxiv - Microbiology 2022Quote: ... and Madin-Darby canine kidney (MDCK) cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2022Quote: ... Madin Darby canine kidney (MDCK, ATCC) cells were grown in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with 10% FBS and penicillin (100 U/ml)-streptomycin (100 μg/ml ...
-
bioRxiv - Microbiology 2020Quote: ... the capsid region was amplified by PCR from pCVB3-XhoI-P1-Kpn2I with Phusion polymerase (Thermo Scientific) and primers HiFi-F (CTTTGTTGGGTTTATACCACTTAGCTCGAGAGAGG ...
-
bioRxiv - Cancer Biology 2019Quote: ... Protein ladder SeeBlue™ Plus 2 Pre-stained Protein Standard (Invitrogen™ through Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... Viruses were grown in Madin-Darby canine kidney (MDCK) cells in Opti-MEM (Life Technologies, Waltham, MA) with 10% fetal calf serum and antibiotics/antimycotics supplemented with 1g/ml tosyl phenylalanyl chloromethyl ketone (TPCK)-trypsin (Worthington Biochemical Corp. ...
-
bioRxiv - Microbiology 2019Quote: One milliliter of monomeric capsid (5 mg/ml) was dialyzed in SnakeSkin dialysis tubing 10K MWCO (Thermo Scientific) using a buffer that is high in salt and contains a reducing agent (buffer 1 ...
-
Genome modularization reveals overlapped gene topology is necessary for efficient viral reproductionbioRxiv - Synthetic Biology 2020Quote: ... The screening of the capsids was carried on FEI Tecnai G2 20 electron microscope (ThermoFisher Scientific, United States) at 200 kV accelerating voltage ...
-
bioRxiv - Microbiology 2019Quote: ... and Madin-Darby canine kidney (MDCK) cells (ATCC) were maintained in cell culture media (Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen) supplemented with 10% fetal calf serum (FCS ...
-
bioRxiv - Microbiology 2020Quote: ... cells (ATCC) and Madin-Darby canine kidney (MDCK) cells (ATCC) were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen) supplemented with 10% FBS ...
-
A Polybasic Domain in aPKC Mediates Par6-Dependent Control of Membrane Targeting and Kinase ActivitybioRxiv - Cell Biology 2020Quote: ... Madin-Darby canine kidney (MDCK) II cells were cultured in MEMα media containing 10% fetal bovine serum (Gibco) and 1% penicillin and streptomycin (Gibco) ...
-
bioRxiv - Microbiology 2020Quote: ... MDCK (Mardin–Darby canine kidney) and Vero E6 cells (ATCC, no.1586) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen) with 10 % FBS ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Madin-Darby Canine Kidney (MDCK) cells were transfected with the pcDNA4-Tbx2a construct using Lipofectamine 3000 (ThermoFisher Scientific) following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: Madin-Darby canine kidney (MDCK; ATCC) and HEK293T (293T) were grown in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2021Quote: Madin–Darby canine kidney (MDCK) cells were grown in minimal essential medium (MEM) (Thermo Fisher Scientific, MA USA) containing 5% newborn calf serum (16010-159 ...