Labshake search
Citations for Thermo Fisher :
1 - 50 of 4850 citations for CD40L Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Kits and murine and human serum CD40L was quantified using the commercially available soluble CD40L ELISA Kits (Thermo Fisher Scientific), following the manufacturer’s procedure.
-
bioRxiv - Bioengineering 2019Quote: ... - CD40L/CD154-FITC (11-1548-42, ThermoFisher), -CD25-PE (120257-42 ...
-
bioRxiv - Immunology 2023Quote: ... 1 μg/mL CD40L-biotin (ThermoFisher, 15836427) was added for 20 minutes at 4°C then washed with cold PBS ...
-
bioRxiv - Immunology 2023Quote: ... CP-870,893 or CD40L (ThermoFisher, 34-8902-81) for 20 minutes at 4°C then washed with cold PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... CH12F3 cells were activated by stimulation with 1 μg/ml CD40L (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... and 1 × 104 CD40L-expressing 3T3 cells were seeded in B cell medium (RPMI 1640 (Gibco) without phenol red containing 5% FCS ...
-
bioRxiv - Immunology 2022Quote: Sorted MBCs (CD19+ IgA+/IgA-) were resuspended with irradiated 3T3-CD40L feeder cells (36, 37) in IMDM (Gibco, 31980-030) supplemented with 10% heat-inactivated (HI)-FBS (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... MIP-1b(CCL4)), growth factors (BDNF, G-CSF, GM-CSF, PDGF-BB, VEGF-A) and other factors (CD40L, Granzyme B) (Invitrogen, Carlsbad, CA). Differences in induction of proteins post stimulation were tested using unpaired t-tests with Welch’s correction ...
-
bioRxiv - Immunology 2021Quote: ... MIP-1b(CCL4)), growth factors (BDNF, G-CSF, GM-CSF, PDGF-BB, VEGF-A) and other factors (CD40L, Granzyme B) (Invitrogen, Carlsbad, CA). Differences in induction of proteins post stimulation were tested using both unpaired (Control-EtOH ...
-
bioRxiv - Microbiology 2024Quote: ... and human (goat anti-human IgG, ThermoFisher) were also used ...
-
bioRxiv - Pathology 2022Quote: ... human CTRP3 (Invitrogen, PA5-115061, rabbit anti-human), α-SMA-Cy3 (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... human (Invitrogen). Cells were cultured in DMEM (Corning Cellgro 10-013-CV ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 10 μL human IgG (Human IgG Isotype Control, ThermoFisher Scientific #02-7102 ...
-
bioRxiv - Neuroscience 2021Quote: ... Hs05441121_cn (human) (ThermoFisher). This line has been submitted to the European Mouse Mutant Archive (EMMA ...
-
bioRxiv - Neuroscience 2021Quote: ... Hs06560655 (human) (ThermoFisher).
-
bioRxiv - Cell Biology 2024Quote: ... Human fibronectin (Invitrogen) was added to stamps at a concentration of 40 µg/ml for 1 hour ...
-
bioRxiv - Cell Biology 2020Quote: ... and VIC labelled human β actin endogenous control probe (Human - 4326315E) or RNA28S5 (Human - Hs03654441_s1) (Thermo Fisher Scientific) so that amplified mRNA can be normalised to β actin or RNA28S5 ...
-
bioRxiv - Neuroscience 2021Quote: ... Human recombinant fibroblast growth factor (human FGF2) (10 ng/ml, Invitrogen) was added to Dulbecco’s Modified Eagle’s Medium (DMEM)/F-12 (Gibco) ...
-
bioRxiv - Immunology 2022Quote: ... Human T cells were activated with human CD3/CD28 Dynabeads (Invitrogen), at a bead:cell ratio of 2:1 and transduced using supernatant collected from Phoenix-AMPHO cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antibodies used for human samples were anti-human CD31 (#17031942, Invitrogen), anti-human CD45 (#17945942 ...
-
bioRxiv - Cancer Biology 2021Quote: ... human BNIP3 (Hs00969291_m1) and human 18S (Hs99999901_s1) were purchased from Applied Biosystems. 18S served as an internal control ...
-
bioRxiv - Microbiology 2022Quote: Human monoclonal antibodies were produced recombinantly in human Expi293F cells (Life Technologies) as described before (83) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human transferrin-568 (ThermoFisher) was added at 10μg mL−1 concentration in serum free media and incubated at 37°C to allow for internalization ...
-
bioRxiv - Immunology 2021Quote: ... then anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 50 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Cancer Biology 2022Quote: Probes Hs00171064_m1 (human, ThermoFisher), Mm00440280_g1 (mouse ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary human hepatocytes (Gibco) were seeded in the top channel at a density of 3.5 x 106 cells/mL using complete hepatocyte seeding media ...
-
bioRxiv - Immunology 2020Quote: ... or anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 25 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Microbiology 2021Quote: ... or human IgG (Invitrogen) as control ...
-
bioRxiv - Bioengineering 2022Quote: ... and human fibronectin (Gibco) at 50 μg/mL in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... human (ThermoFisher Scientific, 902927). Analysis was performed with Transcriptome Analysis Console 4.0 software (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... then anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 50 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% human IgG (Invitrogen) in PBS] followed by incubation with primary antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... human plasma (ThermoFisher, #33016015); Laminin 111 ...
-
bioRxiv - Immunology 2023Quote: ... A Human ProcartaPlexTM (Invitrogen) immunoassay was additionally used to detect 45 human cytokines ...
-
bioRxiv - Immunology 2024Quote: ... Anti-Human-HRP (Invitrogen) was diluted 1:5000 in 1% BSA/PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... CD36 (Human tissue Thermofisher: PA1-16813 1:500 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were tested on preconfigured 96-well qPCR plates (Human glycosylation – 4413255, Human Inflammation - 4418851 or Human tumor metastasis – 4418743, Thermofisher Scientific), with 100 ng added to each well ...
-
bioRxiv - Microbiology 2020Quote: ... we used human monoclonal antibodies produced recombinantly in human Expi293F cells (Life Technologies) as described before (Fang et al ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-human IgG-Alexa647 and anti-human IgG-Alexa568 were obtained from Invitrogen, anti-acetylated tubulin (T7451 ...
-
bioRxiv - Cell Biology 2020Quote: ... and human GAPDH and human KIF18A Taqman probes and primers (Thermo Fisher Scientific) were used for reverse transcription and qRT-PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... and subjected to human total tau ELISA (human tau: # KHB0042, Thermo Fisher Scientific) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...