Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Benzyl 2 3 4 5 6 d5 dimethyltetradecylammonium Bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
bioRxiv - Microbiology 2022Quote: ... 5-diphenyl-2-H-tetrazolium bromide) assay (Invitrogen) was performed to follow the proliferation of KO-SFPQ or siSFPQ HCT116 cells compared to WT or siCtrl HCT116 cells respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... We performed MTT (3-(4,5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide) assay (cat no. V13154; Thermo Fisher) for determining cell viability after different tunicamycin treatments as per the manufacturer’s protocol.
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cell Biology 2024Quote: ... 3-4 or 5-6 and Phusion DNA polymerase (Thermo Fisher Scientific). The resulting PCR mix was DpnI digested and 4 μl of the mix was used for transformation of E ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Immunology 2023Quote: ... MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) (Thermo Fisher) assay was performed by incubating the cells with 50 µg/µl MTT (5 mg/ml stock ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were included in the secondary antibody solution to stain nuclei.
-
bioRxiv - Neuroscience 2023Quote: ... or 4°,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were added during the first wash step to visualize nuclei ...
-
bioRxiv - Cell Biology 2024Quote: ... The same test was done in parallel to assess the cell viability using MTT at 5 ug/mL (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) (Invitrogen). Sixteen sites per well were acquired using a 20x Olympus objective plan fluorite NA 0.45 (1320517 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 μL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, concentration 5 mg/mL, Invitrogen, cat. M6494) in PBS was added to each well containing culture medium and incubated for 2.5 h at 37 °C ...
-
bioRxiv - Biochemistry 2020Quote: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Thermo Fisher Scientific) was added to cells at a final concentration of 2mM and incubated at 37°C in 5%CO2 for 1 h ...
-
bioRxiv - Cell Biology 2024Quote: ... A 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (M2128, Invitrogen) solution was prepared at a final concentration of 0.5 mg/mL and pH 7.4 ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 x 5 min) on a rocking platform and stained with 4′,6-diamidino-2- phenylindole dihydrochloride (DAPI) (Life Technologies) staining (2 μM ...
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole at 5 µg/mL (DAPI; ThermoFisher) in TBS 1% BSA ...
-
bioRxiv - Developmental Biology 2020Quote: ... containing 4’,6-diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Neuroscience 2021Quote: ... and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT, #I00671G, Fisher Scientific).
-
bioRxiv - Pathology 2020Quote: ... 5-diphenyltetrazolium bromide (Invitrogen, USA), known as MTT assay ...
-
HNRNPA2B1 controls an unfolded protein response-related prognostic gene signature in prostate cancerbioRxiv - Cancer Biology 2022Quote: ... (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) (MTT) (M6494, Thermo Fisher Scientific) was added to each well to a final concentration of 0.67 mg/ml and incubated at 37oC ...
-
bioRxiv - Immunology 2021Quote: ... The brains were cleared in BABB (2:1 benzyl alcohol (Honeywell, 108006)/benzyl benzoate (Acros organics, 105862500)) overnight ...
-
bioRxiv - Microbiology 2024Quote: ... cleared using BABB (benzyl alcohol (#1.09626.1000, Supelco, USA): benzyl benzoate (#10654752, Thermo Fisher Scientific, USA (1:2)) and imaged as follows ...
-
bioRxiv - Microbiology 2024Quote: ... Plates were placed in sealed boxes to prevent from drying of the perimetric wells and incubated without shaking at 37°C for 6 days before addition of a mix solution of 20% tween 80 plus MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide] (Stock 5 mg/mL, Acros Organics, Ref. 15224654) or the Bactiter-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Bioengineering 2023Quote: ... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
bioRxiv - Biochemistry 2021Quote: For MQAE (N-(Ethoxycarbonylmethyl)-6-Methoxyquinolinium Bromide) (ThermoFisher) assays U87 cells were seeded into dark 96-well microtiter flat-bottom plates at 4 × 104 cells·well-1 in 100 µL volumes DMEM media supplemented with 10% FBS and 1% Penicillin/Streptomycin and incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... A 3% agarose gel with 4 μL ethidium bromide was loaded with 5 μL PCR reaction and 2 μL GeneRuler 100bp ladder Plus (Thermo Fisher) and run for 40 minutes at 100 volts ...
-
bioRxiv - Microbiology 2021Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MMT) was obtained from Thermo Fisher. Crystal violet was purchased from VWR ...
-
bioRxiv - Molecular Biology 2024Quote: The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT, Thermo Scientific) assay was performed on cells seeded and treated in 96 plates for 72 hours with the free doxorubicin or doxo-EVs ...
-
bioRxiv - Developmental Biology 2022Quote: ... Nuclei were stained with 5 µg / µl 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) and slides were mounted with FluoromountG (SouthernBiotech).
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times and incubated with 4’,6-Diamidino-2-phenylindole (DAPI; 2mg/ml) (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... After washing and nuclear counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher, 3 µM), sections were mounted on microscopic slides using Aqua Poly/Mount (Polysciences) ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA#4: 5’-AUAGCGUUUCUUCUAACUGGGCAGC-3’ (Invitrogen). siRNAs #2 and #4 significantly decreased the mRNA levels to the greatest extent and both had the same mitotic phenotypes ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... with 2% Ethidium Bromide (Invitrogen, Paisley) in 1X TBE buffer (108 g of Tris Base ...
-
bioRxiv - Bioengineering 2020Quote: ... DAPI ((4’,6-diamidino-2 phenylindole, Invitrogen) was added and samples were covered with coverslips ...
-
bioRxiv - Developmental Biology 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) was added to embryos (10 μg/mL in PBST ...
-
bioRxiv - Bioengineering 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen) allowed visualization of the nucleus (1:5000 dilution) ...
-
bioRxiv - Microbiology 2021Quote: ... an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide)) assay (M6494, Thermo Fisher Scientific) was conducted in parallel to the infection and kinase inhibitor treatment according to manufacturer instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... Cytotoxicity was determined by MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (ThermoFisher: M6494) reduction analysis according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Nucleus staining was performed using 4’,6-diamidino-2-phenylindole (DAPI) (3 mM, D3571, Molecular Probes). Cells were counted from four randomly selected fields per culture under a confocal microscope (TCS SP8 ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-[6-(4’-hydroxy) phenoxy-3H-xanthen-3-on-9-yl] benzoate (HPF) from Molecular Probes® and Horse radish peroxidase (HRP ...
-
bioRxiv - Bioengineering 2024Quote: ... DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride, Cas. No. 28718-90-3, Thermo Scientific GmbH, Germany), Tween 20 (Art ...
-
Activation of innate immune cGAS-STING pathway contributes to Alzheimer’s pathogenesis in 5×FAD micebioRxiv - Neuroscience 2022Quote: ... Slides were counterstained with 5 μg/mL 4’,6-diamidino-2-phenylindole (DAPI; ThermoFisher Scientific) for 10 min at room temperature and washed with 1 × PBST (0.2% Triton-X 100 ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Treatments were incubated 2 hours before addition of the MTS (3-(4,5-Dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) reagent (Thermo-Fisher Scientific, Waltham, MA) and incubation was continued another 1.5 hours ...
-
bioRxiv - Zoology 2020Quote: ... 2’-(4-ethoxyphenyl)-5-(4-methyl-1-piperazinyl)-23491-52-3 (Hoechst 33342, trihydrochloride, trihydrate, Life Technologies, H3570) in water for 20 min ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Bioengineering 2024Quote: ... and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT, 0.5mg/ml, #V13154, Thermo Fisher) for 1 h ...
-
bioRxiv - Cell Biology 2023Quote: ... DAPI (4’,6-Diamidino-2-henylindole, dihydrochloride) was obtained from Invitrogen (Catalog: D1306, CAS:28718-90-3).