Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for BD 3 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibody dilutions were prepared in 3% NGS in 1XPBS as follows: anti-mouse α-SMA (1A4, ThermoFisher) at 1:200 and biotinylated anti-mouse IL-1RI (JAMA-147 ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubated overnight in mouse anti-Hu primary antibody at 4°C (1:200 in 3% block; Invitrogen). After three 5-min PB rinses at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary antibody dilutions were prepared in 3% NGS in 1XPBS as follows: anti-mouse α-SMA (1A4, ThermoFisher) at 1:200 ...
-
bioRxiv - Pathology 2019Quote: Mouse inner medullary collecting duct (mIMCD-3) cells were grown in 50% DMEM high-glucose pyruvate (Gibco, 41966052), 50% F-12 Nutrient Mixture (Gibco ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 μg/mL gentamicin (Wisent) and 5 ng/mL recombinant mouse fibroblast growth factor basic (FGF-b, ThermoFisher). At ~90% confluence ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Neuroscience 2019Quote: ... washed 3× in PBS and incubated with Alexa-conjugated anti-mouse secondary antibody (1:500, Alexa Fluor 647, Invitrogen) for 1 h at room temperature ...
-
bioRxiv - Physiology 2020Quote: ... Membranes were washed 3 times with TBST and incubated with anti-mouse IgG secondary antibody (A16017, Thermofisher, 1:10,000) or anti-rabbit IgG secondary antibody (A16035 ...
-
bioRxiv - Microbiology 2020Quote: ... the cells were washed 3 times with PBS containing 0.5% BSA and stained with an AF647 conjugated donkey anti-mouse IgG antibody (Invitrogen) for 1 hour ...
-
bioRxiv - Molecular Biology 2021Quote: ... the cells were washed 3 times with PBS containing 0.5% BSA and stained with an AF647 conjugated donkey anti-mouse IgG antibody (Invitrogen) for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... blocked with 3% BSA and incubated with 1:1000 dilution of mouse anti-P30 (SAG1) primary antibody (Invitrogen MA183499). Cells were then permeabilized and incubated with 1:1000 dilution of rabbit anti-Toxoplasma primary antibody (Invitrogen PA17252 ...
-
bioRxiv - Neuroscience 2023Quote: ... Slides were then washed with PBS 3 times and secondary antibodies (Alexa Fluor 555 goat anti-mouse (Invitrogen A21425) and Alexa Fluor 488 goat anti-rabbit (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... the strips were washed 3 times in PBS-T before incubation in primary antibody (GST Tag Mouse anti-Tag, Clone: 8-326, Invitrogen) for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... The monolayers were washed 3 times with PBS and stained with Alexa Flour 647 conjugated with goat anti mouse IgG (1:2,000, ThermoFisher, A32728) and Alexa Flour 594 conjugated with donkey anti rabbit IgG (1:1,000 ...
-
bioRxiv - Microbiology 2021Quote: ... The plate was washed 3 times before adding 50 μl of 1:1,000 diluted Goat anti-Mouse IgG H+L-HRP antibody (Invitrogen, # 31430) to the plate and incubated for 1 h at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then incubated overnight at 4°C in blocking solution (PBS, 2% normal goat serum, 3% BSA) and primary antibodies (mouse anti-HA, Invitrogen; rabbit anti-GFP, Invitrogen). Cells were then immunolabeled with Alexa-conjugated secondary antibodies (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then washed three times in PBS and incubated with PBS containing 3% BSA and secondary antibodies (Alexa 488 goat anti-mouse; Thermofisher) for 1 hour at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: ... cells were washed 3 x 5 min with PBS before adding secondary antibody (1:200 Alexafluor-488 goat anti-mouse, Invitrogen) and rhodamine phalloidin (1:100 ...
-
bioRxiv - Immunology 2022Quote: ... Deposition of immunoglobulin (IgG) and complement component 3 (C3) in the kidney tissue were stained with PE labeled goat anti-mouse IgG (Invitrogen) and FITC labeled rat anti-mouse C3 (Cedarlane ...
-
bioRxiv - Neuroscience 2022Quote: ... RRID: AB_10541045) for 3 days at 4°C followed by 2h in 1:800 anti-mouse FluoroNanogold (Life Technologies, A24920) at room temperature ...
-
bioRxiv - Biophysics 2022Quote: ... were washed three times in sterile PBS and opsonized overnight at 4°C in 3 mg/mL mouse IgG (Invitrogen). To remove excess antibody ...
-
bioRxiv - Immunology 2022Quote: ... complementary DNA (cDNA) was generated from extracted mouse plasma RNA using primer YB383 5’-TTTTTTTTTTTTTTTTTTTTTTTTRAAGCAC-3’ and enzyme Superscript III (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... The secondary antibody in PBS supplemented with 3% BSA (Thermofisher, Mouse 800, 1:20000 and Thermofisher, Rabbit 680, 1:20000) was incubated in the dark for 1 hour on a rolling platform at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: 20~60μg lysates from culture cells or mouse tissues were separated on 10% Bis-Tris or 3~8% Tris-Acetate Novex NuPAGE gels (Invitrogen) and transferred to nitrocellulose membrane following standard procedures ...
-
bioRxiv - Microbiology 2022Quote: ... isolated primary cells were co-cultivated with gamma-irradiated mitotically inactivated NIH3T3 mouse embryonic fibroblasts (MEFs) in a 3:1 mixture of Ham’s F-12 nutrient mix (Life technologies) and DMEM supplemented with 5 % FCS ...
-
bioRxiv - Cell Biology 2023Quote: ... the iMACs were washed 3 x 5 min with PBS and incubated for 1h with 1:1000 goat anti-mouse IgG-AF488 (A11001, Invitrogen). Afterwards the cells were again washed 3 x 5 min with PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... sections were incubated for 1 hr at room temp in the following secondary antibodies at 1:500 dilution in PBS + 3% BSA: Alexa Fluor 488 Goat Anti-mouse IgG2a (Invitrogen) (binds the CD24 primary antibody) ...
-
bioRxiv - Cell Biology 2023Quote: ... C3H female mouse in origin) were cultured every 2-3 days using 0.25% Trypsin-EDTA and maintained in DMEM (GIBCO, 11965118) supplemented with 20% iFBS and 1% Penicillin/Streptomycin ...
-
bioRxiv - Bioengineering 2023Quote: ... the culture surface was washed 3 times with PBS (-/-) and then Goat anti-mouse Alexa Fluor®546 (RRID: AB_2534089, ThermoFisher) in blocking buffer (1:800 ...
-
bioRxiv - Bioengineering 2023Quote: The specimens of phallodin-AF568-labeled actin in mouse kidney section were commercially available (FluoCells Prepared Slide #3, Invitrogen, F24630).
-
bioRxiv - Neuroscience 2023Quote: ... the membrane was incubated in 10 mL of 3% BSA/TBST (w/v) with 1 µL mouse anti-V5 primary antibody (1:10,000; Invitrogen, R96025) for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: Sac2 knockdown was performed with siRNA targeting mouse gene sequence Inpp5f: 5’-GGAAUGCGGUAUAAACGAATT-3’ and was from Ambion (Life Technologies). OSBP knockdown was performed using ON-TARGET plus SMART pool Mouse OSBP siRNA from Dharmacon ...
-
bioRxiv - Physiology 2024Quote: Mouse DRG neuron cultures were loaded for 30 min at 37 °C with 3 µM Fura-2 AM (Invitrogen F1221) in ES containing also 0.02% Pluronic F-127 and left to recover for about 10 min in ES before recording ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1:3) (60) followed by secondary Alexa Fluor 488 goat α-mouse IgG antibody (Invitrogen / Thermo Fisher Scientific – 1:1,000).
-
bioRxiv - Neuroscience 2024Quote: ... for 20 min at RT and incubated with 3% NGS PBS containing secondary antibodies (1:600, Alexa-Fluor 594 anti-mouse IgG, Invitrogen and Alexa-Fluor 488 anti-guinea pig IgG ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were subsequently washed 3 x 5 mins with PBS and incubated in fluorescently conjugated secondary antibodies (goat anti-mouse Alexa Fluor 488, ThermoFisher #A11001 ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Immunology 2022Quote: miRNAs targeting the 3’ UTR of mouse mDia1 were designed as previously described (89) using BLOCK-iT RNAi Designer (Thermo Fisher), synthesized (Gene Universal) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sections were washed with 1x PBS (3 times; 5minutes each) and incubated with donkey anti-mouse Alexa Fluor Plus 488 IgG (1:500, Thermo Fisher) and donkey anti-rabbit Alexa Fluor Plus 647 IgG (1:500 ...
-
bioRxiv - Bioengineering 2022Quote: Primary neonatal cardiomyocytes were isolated from C57BL/6 mouse neonates on postnatal days 3-5 using the Pierce Primary Cardiomyocyte Isolation Kit (Thermo Fisher) as previously described (14) ...
-
bioRxiv - Genetics 2021Quote: ... or a mouse anti-HA (MBL, M180-3, 1: 200) antibody followed by incubation with fluorescently labeled secondary antibodies (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... and cleavage products were detected using mouse monoclonal BC-3 antibody which detects aggrecan cleavage at the Glu392↓Ala393 bond (Cat n.: MA316888, Life Technologies). Immobilon Chemiluminescent HRP substrate (Cat ...
-
bioRxiv - Neuroscience 2020Quote: ... for 1 h at RT and then incubated for 3 days at 4°C with the monoclonal mouse anti-NeuN antibody conjugated with Alexa-488 (clone A60, Life Technologies) at a concentration of 0.5 µg mL-1 into blocking buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... Tissue was rinsed 3 times in PBS and incubated with the corresponding secondary antibody: goat anti-mouse Alexa-488 (Invitrogen, A32723); donkey anti-mouse Alexa-647 (Jackson ImmunoResearch ...
-
bioRxiv - Neuroscience 2021Quote: ... neurospheres were washed 3 times with PBS and incubated with secondary antibody goat anti-mouse Alexa Fluor 488 (Thermo Fisher Scientific) diluted at 1:1000 for 45 minutes ...
-
bioRxiv - Bioengineering 2020Quote: ... We cloned the wild type Cas13a with a 3’ V5 tag (Cas13a-V5) and appended a 3’ UTR from mouse alpha-globin (Genbank accession # NM_001083955) in a pMA7 vector (GeneArt, Thermo Scientific, USA). Additionally ...
-
bioRxiv - Cancer Biology 2022Quote: EC stimulation was achieved using 30 ng/ml VEGF-A164 (VEGF-A) (mouse equivalent of VEGF-A165) post 3 hours incubation in serum-free medium (OptiMEM®; Invitrogen). VEGF-A was made in-house as previously described by Krilleke et al [56].
-
bioRxiv - Microbiology 2019Quote: ... JE-CVax hyper-immune and non-immune heat inactivated mouse serum samples (starting dilution of 1/9) were serially diluted 3-folds in RPMI 1640 medium (Gibco, ThermoFisher Scientific) supplemented with 4% low IgG serum ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by 3 stringent washes in PBS-tween and application of Alexa flour® 596 conjugated goat anti mouse secondary antibody (A11005, Invitrogen) for 1 hour followed by 3 washes in PBS tween ...
-
bioRxiv - Cell Biology 2020Quote: ... A pool of 4 siRNAs targeting mouse SNAP-47 and control Luciferase siRNA (Target Sequence: 5’-CGTACGCGGAATACTTCGA-3’) (Dharmacon, Thermofisher Scientific) were electroporated along with GFP into E15.5 cortical neurons (2 µg GFP + 50 pmol siRNAs) ...