Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for Arylacetamide Deacetylase Like 4 AADACL4 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... Cells were then incubated with primary antibodies (overnight, 4°C), washed (5X, PBS, 4°C) and incubated with species-specific secondary antibodies coupled to fluorophores (Thermo Fisher). Cells were then washed (5X ...
-
bioRxiv - Neuroscience 2019Quote: ... Supernatant was kept after spinning at 800 rcf for 2’ at +4°C and were incubated overnight at +4°C with 3µg of dedicated antibodies: Nr2f1 antibody (Thermo Fisher PA5-21611) and GFP antibody (Abcam ab13970 ...
-
bioRxiv - Cancer Biology 2022Quote: ... For 4-color immunofluorescence using V5-555 antibody (Invitrogen), after the secondary antibody ...
-
bioRxiv - Immunology 2020Quote: ... antibodies were reduced with 4 mM TCEP (Thermo Fisher) for 30 min at 37 °C and washed two times ...
-
bioRxiv - Neuroscience 2021Quote: ... 4) anti-ApoE antibody (#701241, Invitrogen, Carlsbad, CA, USA); 5 ...
-
bioRxiv - Immunology 2023Quote: ... antibodies were reduced with 4 mM TCEP (Thermo Fisher) for 30 min at 37°C and washed two times ...
-
bioRxiv - Cell Biology 2023Quote: ... Purified human neutrophils and T cells were cultured in Human Plasma-Like Medium (HPLM; ThermoFisher Scientific) with 5% heat inactivated FBS supplemented ...
-
bioRxiv - Microbiology 2019Quote: ... Caspase-like activity was measure with CellEvent™ Caspase-3/7 Green Flow Cytometry Assay Kit (Invitrogen), a nucleic acid-binding dye that harbors the caspase-3/7 cleavage sequence ...
-
bioRxiv - Bioengineering 2021Quote: Our RGD-containing elastin-like proteins (ELP) are expressed in BL21 (DE3) pLysS Escherichia coli (Invitrogen, 1931008) under control of the T7 promoter ...
-
bioRxiv - Plant Biology 2021Quote: The Trx-like domain and CTD were separately dialyzed in a 10 kDa dialysis card (Thermo Fisher) with the Buffer (25 mM Hepes pH 7.5 ...
-
bioRxiv - Neuroscience 2021Quote: ... NSC34 motoneuron-like mouse hybrid cell line (available in house) was cultured in DMEM (Thermo Fisher Scientific) with 5%FBS (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: Long-term media for cortical-like neurons and sensory neurons consisted of Neurobasal (475mL, Life Technologies 21103049), B27 supplement (10mL ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was extracted from sorted FOXL2+ granulosa-like cells using the Arcturus PicoPure kit (Thermo Fisher), or from COV434 cells and hiPSCs using the Monarch Total RNA Miniprep kit (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... microglia-like cells with intracellular cryptococci were washed with Hank’s Balanced Salt Solution (pH 7.2; Thermo Fisher), and the slides were stained with 0.01% acridine orange (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... Primary antibodies were incubated overnight at 4°C and Alexa Fluor-conjugated secondary antibodies (Invitrogen) were incubated for 1 hour at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... 555-conjugated secondary antibody (4 μg/mL; Thermo Fisher Scientific). Nuclei were counterstained with Hoechst 33342 (1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... 4μg/ml Mouse anti-4-Hydroxynonenal Monoclonal Antibody (Thermo Fisher) visualizing lipid peroxidation or 10 μg/ml Mouse Anti-3-Nitrotyrosine antibody (Abcam ...
-
bioRxiv - Microbiology 2023Quote: ... Fluorescently labeled secondary antibodies AF488 (4 µg/ml) (ThermoFisher, A11013) and AF647 (4 µg/ml)(ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: ... 3D12 (anti-HLA-E antibody ; Thermo Fisher # 4-9953-82) or the isotype-matched control Ab (Supplementary Figure 2).
-
bioRxiv - Cell Biology 2020Quote: ... Primary antibodies were incubated overnight at 4°C and horseradish peroxidase (HRP)-conjugated secondary antibodies (ThermoFisher) were incubated at RT for 1 hr ...
-
bioRxiv - Neuroscience 2020Quote: ... IA) with the top ranking promoter-like elements altered by synonymous mutations and cloned into pCR4-Blunt (Invitrogen). Bacterial clones were screened by restriction digestion and those with correct patterns were analyzed by DNA sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... For nuclei staining HL-60 neutrophil-like cells were treated with 0.5□μg/ml Hoechst 33342 (Life Technologies) for 5□minutes at 37□°C and washed in PBS once ...
-
bioRxiv - Cell Biology 2020Quote: 7000 Monkey kidney fibroblast-like COS-7cells were seeded per well in gelatin-coated 96- well plates (Gibco DMEM ...
-
bioRxiv - Microbiology 2021Quote: J774.1 mouse macrophage-like cells (ECACC, Salisbury, UK) were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Thermo Fisher) supplemented with 200 U/ml penicillin/streptomycin ...
-
bioRxiv - Immunology 2023Quote: Human embryonic kidney (HEK) epithelial-like cell line HEK293T was maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) (11965-118; GIBCO™ ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell suspension was incubated with Fc block antibodies for 5 minutes at 4°C and then stained with Thy1.2-FITC antibody and IgG2a isotype antibody (Thermo fisher) as a negative control for 30 minutes at 4 °C ...
-
bioRxiv - Microbiology 2019Quote: ... or 4 µg isotype mouse monoclonal antibodies (ThermoFisher Scientific #02-6200). Immunoprecipitated proteins were immunoblotted for GFP- or HA-epitope tagged ubiquitin with antibodies for GFP (1:3,000 ...
-
bioRxiv - Bioengineering 2022Quote: ... eBCs were stained with polyclonal Synaptotagmin-4 antibody (1:50; Invitrogen) and incubated at 4 °C overnight ...
-
bioRxiv - Immunology 2022Quote: ... incubated with anti-cytokine antibodies (IL-4 (11B11, BD and Invitrogen), IL-13 (eBio13A ...
-
bioRxiv - Microbiology 2022Quote: ... and anti-mIgG-AF647 antibodies (4 μg/ml, Invitrogen #A-31571). Cell staining and washing were performed in PBS-0.1% BSA at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 μl of the Cy5 goat anti-rabbit antibody (Invitrogen, #A10523) and 4 μl of the Alexa Fluor goat anti-mouse antibody (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... for overnight at 4°C and Alexa-labeled secondary antibodies (Invitrogen, A11006 ...
-
bioRxiv - Physiology 2024Quote: ... were incubated overnight at 4°C and the secondary antibodies (Invitrogen) were incubated for 1 h at room temperature.
-
bioRxiv - Molecular Biology 2022Quote: ... 3-4 mg total protein and 2 ug of KIF1C antibody or 10 ug mCherry antibody (Invitrogen mCherry Monoclonal Antibody (16D7)) were used ...
-
bioRxiv - Developmental Biology 2022Quote: ... and incubated with primary antibodies overnight at 4 °C (1:100 mouse anti CYP3A4 antibody, Life Technologies MA5-17064 ...
-
bioRxiv - Cell Biology 2021Quote: ... primary antibodies overnight at 4°C followed by Alexa Fluor-647 secondary antibodies (ThermoFisher Scientific, 1:500) for 2hrs at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... Primary antibodies were then applied at 4°C overnight in 1x PBS supplemented with Horse serum (4%, ThermoFisher, 16050114). The following synaptic antibodies were used ...
-
bioRxiv - Physiology 2020Quote: Caspase-3-like activity was quantified using the EnzChek Caspase-3 Assay kit #1 (Molecular Probes, Eugene, OR, USA). Tissue samples were thawed on ice for 5 min ...
-
bioRxiv - Physiology 2020Quote: ... MCF-10 human mammary epithelial cells and COS-7 fibroblast-like monkey cells were maintained in DMEM (Fisher Scientific) supplemented with 10% fetal bovine serum and 2% penicillin/streptomycin.
-
bioRxiv - Microbiology 2021Quote: ... A549 (male, human lung epithelial-like) cells were obtained from ATCC and grown at 37 °C in DMEM (Gibco) supplemented with 10 % FBS (GE Healthcare Life Science ...
-
bioRxiv - Cell Biology 2022Quote: ... ES03 cells were grown on MEF feeders in KSR+bFGF and passaged enzymatically using trypsin-like enzyme (TrypLE, Invitrogen) for at least 3 passages before electroporation ...
-
bioRxiv - Microbiology 2019Quote: ... The MamK-like gene from strain Poly30T was amplified by standard PCR procedures with Phusion DNA polymerase (Thermo Scientific) using the primers RPA821_NheI (CTAGCTAGCATGACCGACATC ACGACCGAC ...
-
bioRxiv - Microbiology 2021Quote: Green monkey kidney fibroblast-like Cos7 cells were cultured at 37 °C with 5% atmospheric CO2 in Dulbecco’s Modified Eagle Medium (DMEM; Gibco, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... BMEC-like cells in well plates were treated with 10 μM cyclosporin A (CsA; Fisher Scientific #11-011-00), a p-glycoprotein inhibitor ...
-
bioRxiv - Genomics 2021Quote: ... SH-SY5Y neuroblast-like cells were maintained in Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F-12) (Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Cell Biology 2022Quote: ... They were passaged twice weekly by rinsing in phosphate buffered saline and dissociation in Trypsin like-enzyme (ThermoFisher 12604039) before diluting 1:5 into fresh media ...
-
bioRxiv - Immunology 2022Quote: RAW 264.7 murine macrophage-like cells (TIB-71; ATCC) and their derivatives were cultured in RPMI 1640 media (Gibco) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2024Quote: ... African green monkey kidney fibroblast-like cell line (COS-7) was maintained in minimal essential medium (MEM, Gibco/BRL) supplemented with 5% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... They were passaged twice weekly by rinsing in phosphate buffered saline and dissociation in Trypsin like-enzyme (ThermoFisher 12604039) before diluting 1:5 into fresh media ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubated overnight at 4°C with anti-GFP rabbit antibody (Invitrogen) diluted with 1% normal goat serum (NGS ...