Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for Anti Flag Affinity Gel since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... wild-type GBP1 was purified by affinity chromatography (HisPur Cobalt Resin, Thermo Fisher Scientific) and size exclusion chromatography (Superdex 200 26/600 ...
-
bioRxiv - Microbiology 2023Quote: ... a His6 tag for affinity purification using Ni-NTA Agarose Beads (Thermo Scientific Pierce). Full-length antibodies were purified using protein A agarose beads (Thermo Scientific Pierce) ...
-
bioRxiv - Neuroscience 2023Quote: ... The sample was then loaded onto an affinity column (POROS CaptureSelect AAVX; ThermoFisher, #A36652) and eluted with a solution of 0.1M glycine (Merck ...
-
bioRxiv - Immunology 2024Quote: ... The proteins were purified via CaptureSelect™ C-tag affinity matrix (Thermo Fisher Scientific). A further SEC polishing step was performed on a HiLoad 16/600 Superdex 200 pg column (GE Healthcare ...
-
bioRxiv - Cell Biology 2024Quote: ... and His-p115 were affinity purified using Ni-NTA HisPur beads (Thermo Fisher Scientific) from crude E ...
-
bioRxiv - Biophysics 2024Quote: ... and the supernatant was batch-bound with Ni2+-NTA agarose affinity resin (Thermo Scientific). The his-tagged PKA-CF100A was eluted with 50 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 x 106 HEK293 cells were seeded in 10-cm plates and transfected the next day with 5 μg Flag-GFP or Flag-NSP2 plasmids using Lipofectamine2000 (Thermo Fisher Scientific, Cat. # 11668019), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... size selection of the libraries was performed using an E-gel Safe Imager and 2% E-gel size select gels (Invitrogen). Indexed libraries were pooled and 100 bp paired-end sequenced on the same flow cell of an Illumina HiSeq4000 instrument at the Berkeley sequencing facility ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA was analyzed using an E-Gel Power SNAP system on a 2% E-Gel Ex gel (Thermo Fisher Scientific).
-
bioRxiv - Genetics 2022Quote: ... An equal volume of each PCR was then pooled and 100 µL were used for gel extraction from a 4% E-Gel EX Agarose Gel (Invitrogen). The fragment size and quality of the extracted DNA were tested using a 2100 Bioanalyzer system (Agilent) ...
-
bioRxiv - Genomics 2019Quote: ... the amplicon was excised out of the gel and gel purified using the PureLink Quick Gel Extraction and PCR Purification Combo Kit (Invitrogen). The amplicons were sequenced as described above ...
-
bioRxiv - Genomics 2020Quote: ... DNA bands with the correct amplicon sizes were extracted via gel extraction and purification using 2% agarose precast gels (E-Gel EX, Invitrogen) and gel imager (E-Gel Safe Imager connected to E-Gel iBase ...
-
bioRxiv - Biophysics 2023Quote: ... and the 187 bp amplicon was gel purified using a 2% E-Gel™ EX Agarose Gels (ThermoFisher Scientific G401002) and QIAquick Gel Extraction Kit (Qiagen 28704) ...
-
bioRxiv - Microbiology 2023Quote: ... and the resulting 514 bp fragment was gel purified from a 1.5% Agarose gel using the GeneJet Gel Extraction Kit (Thermo Scientific). The plasmid pLenti-DsRed_IRES_EGFP (Addgene plasmid # 92194 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The PCR product from each well was then run on an agarose gel (E-Gel EX Agarose Gels 2%, Invitrogen) with a 50 bp ladder (Invitrogen) ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein material was separated via SDS– polyacrylamide gel electrophoresis (SDS-PAGE) (12, 15, or 17 well gels, 4-20% Bis-tris BOLT gels, Invitrogen), with 1X MOPS Buffer (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... Proteins were separated on precast Novex 10% Tris-Glycine gel / NuPAGE 4-12% Bis-Tris gel at 100V using the Mini Gel Tank (Invitrogen) and were blotted onto PVDF membrane at 20V for 90 min ...
-
bioRxiv - Biochemistry 2023Quote: ... and the 187 bp amplicon was gel purified using a 2% E-Gel™ EX Agarose Gels (ThermoFisher Scientific G401002) and QIAquick Gel Extraction Kit (Qiagen 28704) ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were boiled for 5 min and subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) on either 10% gels (cast freshly) or 4-20% gradient gels (Invitrogen). Proteins were transferred to polyvinylidene fluoride (PVDF ...
-
bioRxiv - Cell Biology 2022Quote: ... USA) or Flag-N-TIR-Sarm1 with Lipofectamine 2000 (Invitrogen), for 48 h using the manufacturer’s protocol ...
-
Targeted degradation of PCNA outperforms stoichiometric inhibition to result in programed cell deathbioRxiv - Cell Biology 2022Quote: ... FLAG-Con1mut-SPOP were subcloned into pEF6 (Thermo Fisher Scientific) using BamHI and NotI such that the CDS is downstream of T7 promoter ...
-
bioRxiv - Plant Biology 2020Quote: ... /MIII- and /MI/II/III-(FLAG) using TRIzol reagent (Ambion) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... Flag immunoprecipitation was performed using Dynabeads Protein G (ThermoFisher Scientific) and FLAG M2 mouse monoclonal antibody (Sigma) ...
-
bioRxiv - Cell Biology 2019Quote: ... FLAG epitope tag (Mouse mAb; ThermoFisher Scientific [FG4R], MA1-91878), GFP (Rabbit pAb ...
-
bioRxiv - Developmental Biology 2019Quote: ... FLAG/HA-tagged AKAP2 was cloned using Gateway technology (Invitrogen) by PCR amplification of the AKAP2 cDNA using attB-flanked BP primers (see Table S2) ...
-
HIV-1 Nef interacts with LMP7 to attenuate immunoproteasome formation and MHC-I antigen presentationbioRxiv - Microbiology 2019Quote: Flag tagged Nef gene was constructed into pLenti vector (Invitrogen). pLenti-Nef plasmids or pLenti empty vectors were co-transfected with pLP1 ...
-
bioRxiv - Cell Biology 2021Quote: ... were transfected with FLAG-α-EPLIN using Lipofectamine 2000 (Invitrogen). After 24hrs ...
-
bioRxiv - Cancer Biology 2022Quote: ... and cloned via BamHI and XhoI into pcDNA3-FLAG (Invitrogen). For cloning of the pGL3_GATA3-3P_AICE_long reporter construct encompassing GATA3Peak_1 ...
-
bioRxiv - Microbiology 2024Quote: ... FLAG-tagged proteins were visualized using Pierce ECL (Thermo Scientific) after treatment with an HRP-conjugated primary antibody directed against the FLAG epitope (Millipore Sigma) ...
-
bioRxiv - Biophysics 2024Quote: ... Proteins were purified with FLAG-functionalized Dynabeads Protein G (Invitrogen), dye-labeled on beads with tetrazine functionalized-Cy3 and ATTO647N (Jena Bioscience ...
-
bioRxiv - Cell Biology 2020Quote: ... SDS-PAGE gel was incubated in Sypro Red protein gel stain (ThermoFisher) at 1:5000 in 7.5% acetic acid for 45 mins ...
-
bioRxiv - Immunology 2020Quote: ... and resolved by SDS gel electrophoresis on 10% Bis-Tris gels (Invitrogen). Resolved proteins were transferred to 0.45 μm Nitrocellulose membranes (Bio-Rad) ...
-
bioRxiv - Biochemistry 2020Quote: ... Gels were stained with ProQ Diamond Phosphoprotein Gel Stain (Thermo Fisher Scientific) according to the manufacturer’s instructions and imaged on a Typhoon Bioimager (GE Healthcare ...
-
bioRxiv - Immunology 2021Quote: ... for reducing gels and 4-12% Bis0Tris NativePAGE gels (Invitrogen, Cat #BN1002BOX) for native ...
-
bioRxiv - Biochemistry 2021Quote: ... The gel was stained with SYBR Gold nucleic acid gel stain (Invitrogen), bands visualized on a UV transilluminator ...
-
bioRxiv - Biochemistry 2020Quote: ... After transfer the gels were stained with Gel Code Blue (Thermofisher, #24952) for 1 hour and then destained with water for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... The gels were subsequently stained with SYBR Safe DNA gel stain (Invitrogen) at 1/10,000 dilution in TBE buffer for 2 h with rocking and visualised using a Gel Doc EZ Imager (Bio-Rad) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Gel electrophoresis was performed using 4-12% Bis-Tris gels (ThermoFisher, NP0326BOX) and run in NuPAGE™ MOPS running buffer (ThermoFisher ...
-
bioRxiv - Systems Biology 2021Quote: ... Barcoded libraries were gel purified using PureLink Quick Gel Extraction kit (ThermoFisher) and sequenced on an Illumina HiSeq2500 using single-read sequencing and were completed with standard primers for dual indexing with HiSeq SBS Kit v4 reagents as described in (Aregger et al. ...
-
bioRxiv - Microbiology 2020Quote: ... gels or NuPage Tris-Acetate 3-8% gels (Invitrogen, Carlsbad, CA, USA). Proteins were transferred using iBlot dry transfer system (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Gel extraction was done using PureLink Quick Gel Extraction kit (ThermoFisher Scientific). Gibson Assembly Master Mix was procured from New England Biolabs ...
-
bioRxiv - Neuroscience 2020Quote: ... the final superpool was gel-purified from 2% agarose gel (Invitrogen, 10135444) with the Zymoclean Gel DNA Recovery kit (Zymo Research ...
-
bioRxiv - Biochemistry 2021Quote: ... The gel was stained with SYBR Gold Nucleic Acid Gel stain (Invitrogen) and imaged with a ChemiDoc MP Imaging system (Bio-Rad Laboratories) ...
-
bioRxiv - Microbiology 2020Quote: ... duplicate gels were stained with SYPRO Ruby protein gel stain (ThermoFisher Scientific) and visualized with UV light.
-
bioRxiv - Physiology 2022Quote: ... The gels were dried using the DryEase mini Gel Drying systems (Invitrogen) according to the manufacture protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Gels were stained with SYBR™ Gold Nucleic Acid Gel Stain (Invitrogen) and imaged on a ChemiDoc™ Touch Imaging System (BioRad) ...
-
bioRxiv - Cell Biology 2022Quote: ... Gel electrophoresis was performed on a 4-12% Bis-Tris gel (ThermoFisher) with 1X NuPage MOPS running buffer (ThermoFisher ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Gels were stained by SYBR™ Gold Nucleic Acid Gel Stain (Invitrogen), imaged by ChemDoc XRS+ (BioRad) ...
-
bioRxiv - Cell Biology 2023Quote: ... Agarose gel electrophoresis was done using gels made with TBE (Thermo Scientific), with DNA visualized under UV ...
-
bioRxiv - Immunology 2023Quote: ... Reverse: ACATCTAAGGGCATCACAGACC) and purified by gel extraction (Quick Gel Extraction kit, Invitrogen). qPCR was performed on a QuantStudio 7 flex and expression calculated using standard curves and results normalised to 18s expression ...